ID: 1041172820

View in Genome Browser
Species Human (GRCh38)
Location 8:55162306-55162328
Sequence GCTGCTACTCTGCACAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041172820_1041172821 10 Left 1041172820 8:55162306-55162328 CCAGCACTGTGCAGAGTAGCAGC 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1041172821 8:55162339-55162361 TTTTAAAATAAGTGAGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041172820 Original CRISPR GCTGCTACTCTGCACAGTGC TGG (reversed) Intronic
900642830 1:3695519-3695541 GCTGCTCCTCAGCACAGGGGTGG - Intronic
900991305 1:6099602-6099624 GCCGCTGCTCTGCACCGAGCTGG + Exonic
901144742 1:7057289-7057311 GCTGCTCCTGTGCACACTGCAGG - Intronic
902205784 1:14867146-14867168 GCTGCTCCCCTGCACAGGGAGGG - Intronic
904648399 1:31986030-31986052 GCCACTACACTGCAAAGTGCTGG + Intergenic
904847976 1:33435078-33435100 GCACCTACTATGCCCAGTGCTGG - Intergenic
908400885 1:63772064-63772086 TCAGTTACACTGCACAGTGCTGG - Intergenic
908576847 1:65468914-65468936 GCTGCTGCTCTGTTCAGTGCCGG + Intronic
909695676 1:78465674-78465696 CCTGCTACTCTTCACTGGGCAGG - Intronic
911202499 1:95059851-95059873 GCTACTATACTGGACAGTGCAGG + Intronic
911746622 1:101448174-101448196 GCTTCTACTCTGCACTGTGTTGG + Intergenic
917139314 1:171818834-171818856 GCTGCTACTTTTCACAGAGAAGG + Intergenic
918997761 1:191784164-191784186 TCTCCTACTGTGCCCAGTGCTGG - Intergenic
919141454 1:193577618-193577640 GCAGATACTCTGCAGAGTGACGG + Intergenic
921418979 1:214924109-214924131 TTTGCTTCTCTGCAGAGTGCAGG + Intergenic
921670631 1:217920327-217920349 TCTGCTGCTCTGCCCAGAGCTGG + Intergenic
922742783 1:228023958-228023980 GCTGAAACTATCCACAGTGCAGG - Intronic
922959955 1:229637907-229637929 GCTGCAGCTCTGCTCAGTGCCGG + Exonic
1065518506 10:26548868-26548890 GCTACTATTCTGCATAGTACTGG - Intronic
1067312381 10:45126426-45126448 GCTGCCACTTAGCACAGTACAGG + Intergenic
1071489055 10:86123577-86123599 GCTGCTACCAAGCCCAGTGCAGG - Intronic
1073562326 10:104507483-104507505 GCTGTGCATCTGCACAGTGCTGG + Intergenic
1074445493 10:113518024-113518046 GCTGCTGTTCTGCACGGTGATGG + Intergenic
1074869985 10:117568777-117568799 CCTGCTACTCTGCAAATTGCTGG - Intergenic
1075345437 10:121678727-121678749 GCTGCTCCCCAGCCCAGTGCTGG + Intergenic
1075912194 10:126134148-126134170 TCTGCTACTCTGAAAAGTGAAGG - Intronic
1076549868 10:131271412-131271434 GCACCTCCTCTGCAGAGTGCAGG - Intronic
1077158190 11:1100805-1100827 GGTGGTCGTCTGCACAGTGCTGG - Intergenic
1077238796 11:1499763-1499785 CCTGCTTCTCGGCACAGTGGTGG - Intronic
1078549632 11:12271206-12271228 GCAGCTGCTCTGCAGGGTGCTGG + Intergenic
1078668694 11:13346476-13346498 GCTGCTCCTCTGAGCAGAGCAGG - Intronic
1079091661 11:17484987-17485009 GATGCTTCTCTCCACACTGCTGG - Intergenic
1079357792 11:19744278-19744300 TCCTCTACTCTGCACAGTGAAGG - Intronic
1081336802 11:41876545-41876567 ACTGCTACTCTGTACATGGCTGG - Intergenic
1082005080 11:47414833-47414855 GCTGCAACTCTCAACAGCGCTGG + Exonic
1087224909 11:95587935-95587957 GAAGCTACTTTGCACTGTGCTGG + Intergenic
1087716730 11:101617087-101617109 GCTGCTGCCTTGCAGAGTGCAGG - Intronic
1089213736 11:116823086-116823108 GCTGCTGCTCTGAGTAGTGCAGG - Intronic
1089362801 11:117902208-117902230 CCTGCTGCTCTGCACAGCACCGG - Exonic
1091614782 12:2041789-2041811 GCTGCTGCTCTTCACAGGGAAGG - Intronic
1093484252 12:19636498-19636520 GGTCATACTCTGCACAGAGCAGG + Intronic
1097383230 12:58920172-58920194 GCTGCTGCTGTGCGCGGTGCTGG - Exonic
1102019899 12:109675099-109675121 GCTTCTTCTCTGCACAGAGAAGG - Intergenic
1105914137 13:24896383-24896405 GCTGCCACACTGCACCATGCAGG - Intronic
1107422906 13:40265986-40266008 GGGGCTACCCTGCACATTGCAGG - Intergenic
1107920482 13:45201880-45201902 GTGGCTTCTCTGCAGAGTGCTGG + Intronic
1108391931 13:49955426-49955448 GCTTCTACTCTGCACTGTGTGGG + Intergenic
1108602238 13:52004948-52004970 GCTGCTGCTCTGGAAGGTGCAGG - Intronic
1109512446 13:63396890-63396912 GCTGCAACCTTGCACAGGGCCGG + Intergenic
1113107224 13:106784710-106784732 GATGCTGCTCTGCAGGGTGCTGG + Intergenic
1117402189 14:55368550-55368572 GATGCTACTCTGCTCTGTTCTGG - Exonic
1118319264 14:64743583-64743605 GCTGGCACTCTGCAGACTGCTGG - Exonic
1118617513 14:67584690-67584712 GCTCCTACTATGTCCAGTGCTGG + Intronic
1120926794 14:89805209-89805231 GCTGCTACATGGCACAGAGCAGG - Intronic
1123100206 14:105792620-105792642 TCTGCTACTCTTCACTCTGCCGG + Intergenic
1123157301 14:106240636-106240658 GCTGCTTCTCTGCAGAGTTCAGG - Intergenic
1123188603 14:106545010-106545032 GCTGCTTCTCTGCAGAGTTCAGG - Intergenic
1124081035 15:26496961-26496983 GCTGTTACTCAACATAGTGCTGG - Intergenic
1124957173 15:34367145-34367167 GCAGCTGCTCTGCAGAGTGGTGG - Exonic
1127127111 15:55822398-55822420 GCTGCCATACTGGACAGTGCTGG - Intergenic
1127171238 15:56304271-56304293 GCTGTTATTCAGCACAGTACTGG - Intronic
1127665363 15:61140761-61140783 GCTGGTACTCTGGGCAGTGGCGG + Intronic
1127807894 15:62537914-62537936 GCTGCTGCTCTTAACAGTGTGGG - Intronic
1127926554 15:63549559-63549581 GCAGCCACTTTACACAGTGCTGG + Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132299031 15:100765215-100765237 GCAGCCACACCGCACAGTGCGGG - Intergenic
1132689075 16:1174476-1174498 GCTGCCACCCTGCAGAGTCCAGG - Intronic
1134850642 16:17475949-17475971 TCTGGTGCTTTGCACAGTGCAGG + Intergenic
1136399375 16:30009490-30009512 GATGCTACAGTGCAGAGTGCAGG + Exonic
1137773869 16:51039990-51040012 GGTTCTGCTCTGCACAGAGCTGG + Intergenic
1138180053 16:54935122-54935144 TCTCCGACTCTGCAAAGTGCAGG - Intergenic
1140202200 16:72903843-72903865 GCTGGGTCTCTGCATAGTGCAGG - Intronic
1140756961 16:78076316-78076338 GCTGCCACACTGCATAGTGCTGG + Intergenic
1141389899 16:83655824-83655846 GCTGCTACTATGCAGAGGACAGG + Intronic
1143409964 17:6702876-6702898 TCTGCTCCTCTGCAGAGTCCTGG - Intronic
1146186500 17:30727802-30727824 GCTGCTATTCTGCAGGGTTCTGG - Intergenic
1146722322 17:35132171-35132193 TCTGCTACTCTGTACCTTGCTGG - Exonic
1147121149 17:38335813-38335835 GCTGCTCCTCTGCAGAATGAAGG - Intronic
1147159814 17:38563260-38563282 GCTCCTCCTCTGCAGGGTGCTGG - Intronic
1148221270 17:45864077-45864099 GTTGTTACTCTGCACAGTCAGGG - Intergenic
1148744533 17:49911011-49911033 CCTTCTACTCTTCACTGTGCGGG + Intergenic
1148823550 17:50375732-50375754 GCTGCTGCTCTGGCCAGGGCAGG - Exonic
1150693922 17:67387976-67387998 GCTGCCATACTGGACAGTGCAGG + Intronic
1151427588 17:74041078-74041100 GCTGCTAATCTGTAAAGTGGGGG - Intergenic
1152302512 17:79503632-79503654 GCTGCCACACTGCACGGTGCAGG + Intronic
1152311189 17:79550976-79550998 GCTACCACACTGGACAGTGCAGG - Intergenic
1152467471 17:80474340-80474362 CCTGCTACTGTGCCCATTGCTGG - Intronic
1152576359 17:81143031-81143053 GCGCCTACTCAGCACAGAGCTGG + Intronic
1155209163 18:23586286-23586308 GCTGCTACTGTGTCCAGCGCAGG - Exonic
1155354078 18:24934826-24934848 GCTGCCACTCGGCACACTGTGGG + Intergenic
1161564963 19:4996891-4996913 GCTGCTGCTCAGCACCCTGCAGG - Intronic
1161796144 19:6387746-6387768 GCACCTACCCTGCAAAGTGCTGG + Intronic
1162694396 19:12461462-12461484 GCTTCTCCACTGCACTGTGCAGG - Intronic
1162972342 19:14188255-14188277 GCTGCTATTCTGCAGGGTTCTGG + Intronic
1163644234 19:18479215-18479237 GATGCTGCTCAGCACACTGCAGG + Intronic
1164639581 19:29813962-29813984 GCTGCTGCTCTGCAAAGTGAGGG - Intronic
1165232116 19:34393784-34393806 GCTGGTTCTCTGCCAAGTGCTGG + Intronic
1166237054 19:41464296-41464318 GCTATTACTCCCCACAGTGCGGG - Intergenic
1167468204 19:49661266-49661288 GCTGCTGCACCGGACAGTGCAGG + Intronic
928028265 2:27757118-27757140 GCTGAAACTCTGCAAAGAGCAGG - Intergenic
928340025 2:30435056-30435078 CCTGTTTCTCAGCACAGTGCTGG - Intergenic
929100436 2:38306861-38306883 ACTGCTATTCTACACAGTACTGG + Intronic
929421424 2:41793759-41793781 GGAGCTATTCTGCACATTGCAGG - Intergenic
930089813 2:47523597-47523619 GCTGCCACTCTGCACTGCCCTGG - Intronic
930508425 2:52313999-52314021 GCTGCCACGTTGCACTGTGCAGG + Intergenic
930854689 2:56001373-56001395 GCTGCTAATCTTTAAAGTGCTGG + Intergenic
932189437 2:69727368-69727390 ACTGCTACTCTATACACTGCTGG - Intronic
935664890 2:105502217-105502239 GCTGCTATTCAACATAGTGCTGG + Intergenic
935925971 2:108068766-108068788 GGTTCTCCTCTGCAAAGTGCGGG + Intergenic
936161779 2:110088907-110088929 CCTGTTGCTCTGCACAGTCCTGG + Intronic
936182884 2:110282447-110282469 CCTGTTGCTCTGCACAGTCCTGG - Intergenic
936242192 2:110797503-110797525 GCTGCTACTCTAAGCAGTGGTGG + Intronic
938140148 2:128788113-128788135 GCTGCCGTTCTCCACAGTGCGGG - Intergenic
939064550 2:137466926-137466948 GAGGCTACTCTGCAAACTGCTGG - Intronic
941319933 2:164041616-164041638 GTTGCTAGGCTGCACAGAGCAGG + Intergenic
944022586 2:195124958-195124980 GCTGTGACTCTGCACAGAGCTGG - Intergenic
947055477 2:226095741-226095763 GCTGCTATTCAACATAGTGCTGG + Intergenic
1168836500 20:881236-881258 GCTGGATCTCTGCACAGTCCTGG + Exonic
1169505949 20:6211935-6211957 GCTTCTATTCAGCACAGTACTGG + Intergenic
1171460235 20:25294018-25294040 GCTGCTGCCCTGGACCGTGCAGG + Intronic
1172163295 20:32883431-32883453 GCTTCTACTCTGCACTGTGTGGG + Intronic
1172845071 20:37925364-37925386 TCTGCTCCTCTGTACAGTTCGGG - Intronic
1173075105 20:39810850-39810872 GCCTCTCCTCTTCACAGTGCAGG - Intergenic
1173294996 20:41748348-41748370 GCTGCTCCTCAGCACCGTGGAGG + Intergenic
1173731275 20:45330394-45330416 GTTGCTGCCCTGCACAGTGCTGG + Exonic
1173979935 20:47216055-47216077 GCTGCTCCTCTGCCCTCTGCAGG - Intronic
1174222238 20:48965592-48965614 GCTGCTGCATTGCACAGTTCTGG + Intronic
1179398723 21:41064493-41064515 GCTGCTGCTCTGCTCCTTGCAGG + Intergenic
1179503177 21:41822476-41822498 GCTGCTTCTCAGCCCGGTGCTGG - Intronic
1180860764 22:19080516-19080538 GCTACTACACTGGACAGTGTTGG + Intronic
1181508737 22:23379300-23379322 GCTGATGCCCTGCACAGTGAGGG - Intergenic
1183167008 22:36155672-36155694 CCTGCTCCTCTGCTCTGTGCTGG - Intronic
950469415 3:13175190-13175212 GCTGGTACTCGGCACACAGCTGG - Intergenic
953677223 3:45012401-45012423 GCTGCTTCTCTCCACAGGGATGG - Intronic
959232518 3:103673590-103673612 GCTACTATATTGCACAGTGCAGG - Intergenic
959478112 3:106837151-106837173 GCTGCTGCTCTGAACAGGGTTGG - Intergenic
961262382 3:125612597-125612619 AGTGCTAATCTTCACAGTGCTGG + Intergenic
962193242 3:133333142-133333164 GCTACTATACTGGACAGTGCAGG - Intronic
965631454 3:170737347-170737369 GCTTCTTTTCTGCACAGTGAAGG + Intronic
969921959 4:10548701-10548723 CCTGTTCCTCTGCACAGGGCAGG - Intronic
974715998 4:65669632-65669654 GCTGCTACTCTGCACCTCGACGG - Exonic
978436170 4:108686845-108686867 CCTTCTAATCTGGACAGTGCAGG - Intergenic
981624057 4:146736528-146736550 GCTTCTACTCTGTACTGTGTGGG - Intronic
986282669 5:6336407-6336429 TCTGTTACTTAGCACAGTGCAGG + Intergenic
987114614 5:14716250-14716272 GCTCCTCCTCGGCAAAGTGCTGG - Intronic
988900336 5:35724988-35725010 GCTGTTACTCTGCGTAGAGCTGG - Intronic
988914598 5:35879905-35879927 GCCACTACTCTGCAGACTGCAGG - Intergenic
989186922 5:38634892-38634914 GCTTCTCCTCTGCACTGTGTGGG - Intergenic
989236831 5:39157841-39157863 GCTGGTCTTCTGGACAGTGCAGG + Intronic
990855956 5:60266562-60266584 GCTGGTAATCTGCAAAGGGCAGG + Intronic
995982471 5:118121144-118121166 TTTGCTACTGTGAACAGTGCTGG + Intergenic
996618498 5:125470741-125470763 GCTGCCACTCTGCACAGTGGGGG + Intergenic
997464079 5:134075119-134075141 GCTGCTACTATTCACAGTACTGG + Intergenic
1001647198 5:173290732-173290754 GCTGCAGCTCTGCACAGAGAGGG + Intergenic
1005945124 6:30589823-30589845 GCAGCTGCTCTGCATACTGCTGG - Exonic
1006406389 6:33848175-33848197 GCTGCTATTCTTGACAGTACTGG + Intergenic
1008226185 6:48919862-48919884 GCTGCTGCTTTGAAGAGTGCTGG + Intergenic
1009600484 6:65791246-65791268 CCAGCTACTCAGCACAGGGCAGG + Intergenic
1010096748 6:72055533-72055555 ACTCCTATTCAGCACAGTGCTGG - Intronic
1011515797 6:88151263-88151285 GCTACTATACTGGACAGTGCAGG + Intronic
1013289282 6:108706863-108706885 GCTGTAGCTCCGCACAGTGCAGG - Intergenic
1013385722 6:109628351-109628373 GCTGCTCTGCTTCACAGTGCAGG + Intronic
1013883497 6:114933734-114933756 CATGCTACTCTCCACAGGGCTGG - Intergenic
1015273993 6:131365763-131365785 GTGGCTACTCAGCACAGGGCTGG - Intergenic
1016425247 6:143929116-143929138 ACTGCTATTCAGCACAGTACAGG - Intronic
1019127842 6:169852718-169852740 GTTCTTACTCTGCACAGTACCGG + Intergenic
1020029222 7:4921053-4921075 GCTGCCAACCTGGACAGTGCAGG + Intronic
1021232900 7:18107143-18107165 GCTCCTAATCTACACAGGGCAGG - Intronic
1022354859 7:29604317-29604339 CCTGCTACTCTGCCTAGAGCTGG + Intergenic
1022530832 7:31065972-31065994 GGAGCTACTCTGGACCGTGCCGG + Intronic
1024177465 7:46855895-46855917 TCTGCTACTCTGAAAAGTGGTGG + Intergenic
1024318298 7:48041531-48041553 GCTGCCACACTGAACAGGGCAGG - Intronic
1024498667 7:50076381-50076403 GCTGTTACTCAACATAGTGCTGG + Intronic
1027435835 7:78163601-78163623 GTTTCTGGTCTGCACAGTGCTGG + Intronic
1028327767 7:89548010-89548032 GCTGCTACTTTTAACAATGCAGG - Intergenic
1028724061 7:94067471-94067493 GCTGGTGCTCTGCCCACTGCAGG - Intergenic
1030012948 7:105189423-105189445 GCAGCTGCTCTGGACAGGGCAGG - Intronic
1030770192 7:113464899-113464921 GCAGCCACTATGCAAAGTGCTGG - Intergenic
1031652959 7:124314417-124314439 GCTGCTCATCTGCACACTGGAGG + Intergenic
1031748585 7:125539453-125539475 GGATCTACTCTGCACAGTGCTGG + Intergenic
1032571721 7:133007539-133007561 GCTGCCATTCTGCACACTGCTGG - Intronic
1033008521 7:137593564-137593586 GCTGCTGCGTTGGACAGTGCAGG - Intronic
1033082434 7:138310922-138310944 GCTTCTACTCTGCATTGTGTAGG + Intergenic
1034062352 7:148104492-148104514 ACTCCTGCTCTGCACAGTGGTGG + Intronic
1034349660 7:150407695-150407717 GCTGCTCCTCTGCAGGGTGGTGG - Intronic
1035543340 8:459173-459195 GCACCTGCTCTGCACAGGGCTGG + Intronic
1038686432 8:29723067-29723089 GCTGCTACTGAGCACAGCTCTGG - Intergenic
1038746061 8:30256240-30256262 GGTGATACTGTGCACAGTGGTGG + Intergenic
1041172820 8:55162306-55162328 GCTGCTACTCTGCACAGTGCTGG - Intronic
1041956478 8:63561917-63561939 GCTGCAACCTTGCACAGAGCTGG + Intergenic
1043585118 8:81759839-81759861 CTTCCTACCCTGCACAGTGCAGG + Intergenic
1043761294 8:84071809-84071831 ACTCCTACTCTGCATAGTACTGG - Intergenic
1045089019 8:98719740-98719762 GCTGATACTCTTCAAGGTGCTGG + Intronic
1046246106 8:111565180-111565202 GCTGCTACATTGCACAGAGGAGG + Intergenic
1047969190 8:130070470-130070492 GCTTCTACTCTGCACTCTGCAGG - Intronic
1048032141 8:130642768-130642790 GCTTCTACTCTGAGCATTGCAGG - Intergenic
1050971997 9:11889584-11889606 GCTTCTATTCAACACAGTGCTGG - Intergenic
1051355306 9:16234923-16234945 GCTGCAGCCCTGCACAGAGCTGG + Intronic
1051634326 9:19167794-19167816 ACTCCTATTCTGCACAGTGCTGG - Intergenic
1052691384 9:31820690-31820712 GCTACTACTTTGCTCTGTGCTGG - Intergenic
1053382352 9:37659337-37659359 GCTGCTGCTCTGAAGGGTGCCGG + Intronic
1053406756 9:37883620-37883642 GCAGCTACTCAGCCCAGGGCAGG - Intronic
1053521385 9:38783468-38783490 GCTCCTATTCAACACAGTGCTGG + Intergenic
1053607851 9:39679172-39679194 CCTGCTACTCCTCACTGTGCAGG + Intergenic
1054193550 9:62007461-62007483 GCTCCTATTCAACACAGTGCTGG + Intergenic
1054245683 9:62663237-62663259 CCTGCTACTCCTCACTGTGCAGG - Intergenic
1054559809 9:66697768-66697790 CCTGCTACTCCTCACTGTGCAGG - Intergenic
1054644858 9:67581230-67581252 GCTCCTATTCAACACAGTGCTGG - Intergenic
1055272978 9:74582681-74582703 ACTGCTCCTCTGGACAGAGCAGG + Intronic
1057421254 9:94914726-94914748 GCTGCTGATCTGCACTGTGGTGG - Intronic
1057736305 9:97664733-97664755 GCTGAGACTCTGCACATAGCTGG - Intronic
1060759937 9:126238559-126238581 CCTGCTGCTCTGCCCATTGCAGG - Intergenic
1060785668 9:126450182-126450204 GGCTCTGCTCTGCACAGTGCAGG - Intronic
1186362769 X:8859877-8859899 GCTACTTCACTGAACAGTGCAGG - Intergenic
1187040142 X:15585998-15586020 GCTTCAGCTCTGCAAAGTGCTGG - Intronic
1187259402 X:17671286-17671308 GCTGCAGCTCTGCTGAGTGCTGG - Intronic
1188364674 X:29300630-29300652 GCTGTTATTCTGCACAGTATTGG - Intronic
1190444710 X:50512621-50512643 GCTGCTATTCAACACAGTGCTGG + Intergenic
1190534443 X:51411675-51411697 GCTACTATACTGAACAGTGCTGG + Intergenic
1193477934 X:81990009-81990031 GCTGCTTCTCTACACTGTCCAGG - Intergenic
1193569760 X:83127917-83127939 GCTGCTGCTTTGCACAGGGAGGG - Intergenic
1194403700 X:93468248-93468270 TGTGCTACTCTTCACAGGGCAGG + Intergenic
1197393684 X:125898949-125898971 GCTGCTACCATGGACAGAGCTGG - Intergenic
1198396594 X:136225377-136225399 GCTGCAACTCTCCTCACTGCAGG - Intronic