ID: 1041173663

View in Genome Browser
Species Human (GRCh38)
Location 8:55171306-55171328
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041173659_1041173663 -8 Left 1041173659 8:55171291-55171313 CCATCATCTGTTACAGCGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1041173663 8:55171306-55171328 GCGTCTGGTGGGAGACACAATGG No data
1041173658_1041173663 -3 Left 1041173658 8:55171286-55171308 CCTTACCATCATCTGTTACAGCG 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1041173663 8:55171306-55171328 GCGTCTGGTGGGAGACACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr