ID: 1041174020

View in Genome Browser
Species Human (GRCh38)
Location 8:55174760-55174782
Sequence ACTTAGAGACAATTCAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041174014_1041174020 3 Left 1041174014 8:55174734-55174756 CCCAGTTGACAGGATAATCCTGC 0: 1
1: 0
2: 1
3: 5
4: 168
Right 1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG No data
1041174015_1041174020 2 Left 1041174015 8:55174735-55174757 CCAGTTGACAGGATAATCCTGCA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041174020 Original CRISPR ACTTAGAGACAATTCAGGGA TGG Intronic
No off target data available for this crispr