ID: 1041174760

View in Genome Browser
Species Human (GRCh38)
Location 8:55183918-55183940
Sequence AGGTGTGTACACATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041174757_1041174760 15 Left 1041174757 8:55183880-55183902 CCTATTAGTGTTCTCTTTATGTA 0: 1
1: 0
2: 3
3: 32
4: 281
Right 1041174760 8:55183918-55183940 AGGTGTGTACACATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041174760 Original CRISPR AGGTGTGTACACATTGAGGA TGG Intronic
No off target data available for this crispr