ID: 1041177206

View in Genome Browser
Species Human (GRCh38)
Location 8:55209118-55209140
Sequence TGGAATTTACTGGCTTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 561}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177206_1041177212 13 Left 1041177206 8:55209118-55209140 CCATCCCAAGCCAGTAAATTCCA 0: 1
1: 0
2: 2
3: 45
4: 561
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177206_1041177214 24 Left 1041177206 8:55209118-55209140 CCATCCCAAGCCAGTAAATTCCA 0: 1
1: 0
2: 2
3: 45
4: 561
Right 1041177214 8:55209165-55209187 CAATGAACGTGGCCCCAAAGAGG No data
1041177206_1041177215 25 Left 1041177206 8:55209118-55209140 CCATCCCAAGCCAGTAAATTCCA 0: 1
1: 0
2: 2
3: 45
4: 561
Right 1041177215 8:55209166-55209188 AATGAACGTGGCCCCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177206 Original CRISPR TGGAATTTACTGGCTTGGGA TGG (reversed) Intronic
900358997 1:2278986-2279008 TGGAGCTTACTGTCTGGGGAGGG - Intronic
900736568 1:4303077-4303099 TGGAATGGAATGGCATGGGATGG - Intergenic
901005047 1:6167516-6167538 TGGAAATTGGTGGCATGGGAGGG - Intronic
905672255 1:39799524-39799546 TGGAATTCACAGGCTGGGGCCGG + Intergenic
905674705 1:39817284-39817306 TGGAATTCACAGGCTGGGGCCGG - Intergenic
906682117 1:47735027-47735049 TGGAATTTAGTGTATTGTGAAGG - Intergenic
908041154 1:60115090-60115112 TTGCAATTACTGGCTTGGGTAGG + Intergenic
909584039 1:77269748-77269770 TGGAATCTACTGGCTTAGTTAGG + Intergenic
912588202 1:110786546-110786568 TGGAAGTTACTGGTTTATGAAGG + Intergenic
913333247 1:117684619-117684641 AGGATTTTATTGGGTTGGGAAGG - Intergenic
914327235 1:146631257-146631279 TGGCAGTAACTGACTTGGGATGG - Intergenic
914734956 1:150407003-150407025 AAGAATTTACTGGCTAGGCATGG - Intronic
917924908 1:179781515-179781537 TGGACTATACTCTCTTGGGATGG + Intronic
918168016 1:181969392-181969414 TGGAACGTGCTGGCTGGGGAAGG + Intergenic
918371107 1:183862412-183862434 TGGAACTTAATGGACTGGGATGG - Intronic
918470610 1:184869072-184869094 TGGAATTCCCTGGCCTGGGGTGG - Intronic
919515743 1:198520376-198520398 TGCAATTTACAGGCTTGCAAAGG - Intergenic
921180390 1:212627043-212627065 TGGATTTTCCAGGGTTGGGAGGG - Intergenic
922268897 1:224013993-224014015 TGGAATTTACTCGAATGGGATGG + Intergenic
922268901 1:224014023-224014045 TGGAATTTACTCGAATGGAATGG + Intergenic
922268944 1:224014392-224014414 TGGAATGTACTGGAATGGAATGG + Intergenic
923543398 1:234906364-234906386 TGGAAGTTATTGGCTGGGCAAGG - Intergenic
924584280 1:245348265-245348287 TGGAAGTTACGGGCCTGGGAGGG - Intronic
1063756355 10:9014259-9014281 TGTAATTTACTAGCTGGGGATGG + Intergenic
1063842819 10:10091077-10091099 TGGAATTCACTGGCAGGTGAAGG + Intergenic
1066738907 10:38502890-38502912 TGGAATTTAATGGAATGGAAAGG + Intergenic
1066740736 10:38516971-38516993 TGGAATTGACTGGAATGGAATGG + Intergenic
1066742356 10:38529166-38529188 TGGAATTGACTCGATTGGAATGG + Intergenic
1066742916 10:38576689-38576711 TGGAATGTACTGGAATGGAATGG + Intergenic
1066743007 10:38577363-38577385 TGGAATGTACTGGAATGGAATGG + Intergenic
1066743026 10:38577513-38577535 TGGAATTTAATGGAATGGAATGG + Intergenic
1066763766 10:38784182-38784204 TGGAATATACTGGAATGGAATGG - Intergenic
1066763883 10:38785182-38785204 TGGAATTTAATGGAATGGAATGG - Intergenic
1066764152 10:38787434-38787456 TGGAATGTACTGGAATGGAATGG - Intergenic
1066764260 10:38788369-38788391 TGGAATTTAATGGAATGGAATGG - Intergenic
1066764996 10:38794662-38794684 TGGAATTGAATGGATTCGGAAGG - Intergenic
1066766899 10:38811004-38811026 TGGAATTGACTGGAGTGGAATGG - Intergenic
1066767181 10:38813423-38813445 TGGAATTTACTAGAATGGAATGG - Intergenic
1066767572 10:38816633-38816655 TGGAATTGACTGGAATGGAATGG - Intergenic
1066769606 10:38833847-38833869 TGGAATTTACTCGAATGGAATGG + Intergenic
1066770690 10:38843069-38843091 TGGAATTGACTGGAGTGGAATGG + Intergenic
1066770698 10:38843139-38843161 TGGAATTTACTCGAATGGAATGG + Intergenic
1066772664 10:38859249-38859271 TGGAATTTAATGGAATGGAATGG + Intergenic
1066773970 10:38869932-38869954 TGGAATTGACTGGAATGGAATGG + Intergenic
1066775343 10:38881245-38881267 TGGAATGTACTGGAATGGAATGG + Intergenic
1066775572 10:38883239-38883261 TGGAATGGACTGGATTGGAATGG + Intergenic
1066775593 10:38883409-38883431 TGGAATTTAATGGAATGGAAGGG + Intergenic
1066775892 10:38885877-38885899 TGGAATGTACTGGAGTGGAATGG + Intergenic
1066776106 10:38887689-38887711 TGGAATGGACTGGATTGGAATGG + Intergenic
1066777008 10:38895195-38895217 TGGAATGGACTGGATTGGAATGG + Intergenic
1066938207 10:41861942-41861964 TGGAATGTACTGGAATGGAAAGG + Intergenic
1066938238 10:41862122-41862144 TGGAATTTAATGGAATGGAATGG + Intergenic
1066938483 10:41863795-41863817 TGGAATTTAATGGAATGGAATGG + Intergenic
1066938487 10:41863820-41863842 TGGAATTTAATGGAATGGAATGG + Intergenic
1066938491 10:41863845-41863867 TGGAATTTAATGGAATGGAATGG + Intergenic
1066939919 10:41872930-41872952 TGGAATTTAATGGAATGGAATGG + Intergenic
1066940181 10:41874664-41874686 TGGAATTTAATGGAATGGAATGG + Intergenic
1066940584 10:41877212-41877234 TGGAATTTAATGGAATGGAATGG + Intergenic
1066941071 10:41880269-41880291 TGGAATTTAATGGAATGGAATGG + Intergenic
1066942560 10:41889673-41889695 TGGAATTTAATGGAATGGAATGG + Intergenic
1066943338 10:41894620-41894642 TGGAATTTAATGGAATGGAATGG + Intergenic
1066943566 10:41896054-41896076 TGGAATTTAATGGAATGGAATGG + Intergenic
1066944039 10:41899122-41899144 TGGAATTTAATGGAATGGAATGG + Intergenic
1066944828 10:41904168-41904190 TGGAATCTAATGGCATGGAATGG + Intergenic
1066945051 10:41905602-41905624 TGGAATTTAATGGAATGGAATGG + Intergenic
1066945456 10:41908148-41908170 TGGAATTTAATGGAATGGAATGG + Intergenic
1066945661 10:41909458-41909480 TGGAATTTAATGGAATGGAATGG + Intergenic
1066946269 10:41913267-41913289 TGGAATTTAATGGAATGGAATGG + Intergenic
1066970262 10:42306820-42306842 TGGAATTTACTCGAATGGTACGG - Intergenic
1066970427 10:42308047-42308069 TGGAATGTAATGGATTGGCATGG - Intergenic
1066970553 10:42308962-42308984 TGGAATGTACTCGATTGGAATGG - Intergenic
1066970635 10:42309527-42309549 TGGAATGTAATGGATTGGAATGG - Intergenic
1066970670 10:42309791-42309813 TGGAATTGAATGGAGTGGGATGG - Intergenic
1066970719 10:42310136-42310158 TCGAATTTAACGGCATGGGATGG - Intergenic
1069840903 10:71338784-71338806 TGTCATTTGCTGGCTTGGGCAGG + Intronic
1072237841 10:93468603-93468625 TGGAAATTCTTGGCCTGGGAGGG - Intronic
1073391989 10:103186622-103186644 TGGCATTTACTGGCTGGGTGCGG + Intronic
1074458947 10:113619691-113619713 TGGACTTTTCTGGGTGGGGAGGG - Intronic
1077969486 11:7173610-7173632 TGGAAATTACTGGCCGGGCACGG + Intergenic
1078127962 11:8586525-8586547 TATAATTTATTGGCTTGGGCTGG + Intronic
1078742350 11:14078887-14078909 TGGAATTTACTGGGTTGATTTGG - Intronic
1085945309 11:81263405-81263427 TGAAATTTATTGTCATGGGATGG - Intergenic
1086413730 11:86568562-86568584 TGAAATTTACTGGCATCAGAGGG + Intronic
1086647082 11:89236194-89236216 TGGAATTTTGTGGTTTGGCAGGG - Intronic
1087771912 11:102220076-102220098 TGGACTTCACTGGCTGGGCATGG + Intronic
1089522526 11:119074939-119074961 TGGAATTTTCTGCCTTAAGAAGG + Intronic
1089856406 11:121548982-121549004 TAGAATTTACAGGTTTGGAAGGG + Intronic
1089932965 11:122332987-122333009 TGTAAATTACTGGATTGGGTTGG - Intergenic
1091648659 12:2292974-2292996 TGGAATTTCCTGGGTTGCCAAGG - Intronic
1095765278 12:45887609-45887631 TGGAATTTACTGGATGAGAACGG + Intronic
1096725868 12:53562038-53562060 AGGAATTTTCTGTTTTGGGAAGG + Intronic
1097644181 12:62216348-62216370 TAAAATTTACTGTCTTGGGAAGG - Intronic
1099332501 12:81307253-81307275 AGGATTTTACTGTCTTGGGTTGG - Intronic
1101550629 12:105758250-105758272 AGGAAATTACAGGCTTGGAAGGG + Intergenic
1102676953 12:114665554-114665576 TGGAAATAACTGGCTTGAGTAGG - Intergenic
1103519037 12:121525539-121525561 TGGAATGTACTGGCGTGGCACGG - Intronic
1103810395 12:123608841-123608863 TGGACTTCACTGGCTTGAGTGGG + Intronic
1106811520 13:33362813-33362835 TGGAATTTACAGTCTAGTGAAGG - Intergenic
1109375858 13:61492058-61492080 TGGAATATGCTGGCTGGGCACGG + Intergenic
1113660365 13:112103437-112103459 TGGATTTCAGGGGCTTGGGAAGG - Intergenic
1113781279 13:112979013-112979035 TGGGAGCTGCTGGCTTGGGACGG + Intronic
1114498919 14:23153790-23153812 TGGACTGGACTGGCTTGGAAAGG + Intronic
1115336997 14:32252095-32252117 TGGAATTGTGTGGCTTGGTAAGG + Intergenic
1117025585 14:51616614-51616636 TGGGGTTTACTGGCCTGGGGTGG + Intronic
1117265627 14:54083570-54083592 AGGCATTTACTGGCTTGTGGTGG - Intergenic
1119137352 14:72232856-72232878 TGGGATTGACTGCCCTGGGAGGG + Intronic
1119260469 14:73235408-73235430 TAGCAATTACTGGCTTGGGCAGG - Intergenic
1119466376 14:74862062-74862084 TGGAATTTAAGGACCTGGGAAGG - Intronic
1119650957 14:76382415-76382437 TGCAATTTTCTGGCCTGGGTAGG + Intronic
1121078494 14:91088864-91088886 AGGAACTTCCTTGCTTGGGAGGG - Intronic
1202874763 14_GL000225v1_random:197180-197202 TGGAATTTAATGGCATGGAATGG + Intergenic
1202875166 14_GL000225v1_random:200298-200320 TGGAATGTAATGGATTGGAATGG + Intergenic
1124054980 15:26233966-26233988 TGGAAAGTGCTGGTTTGGGAAGG - Intergenic
1125359556 15:38850656-38850678 AGGAATTGACTGGCCTGGCACGG + Intergenic
1126267326 15:46769898-46769920 GGGCATTTACTGCCTTGGTATGG - Intergenic
1128413055 15:67418264-67418286 TGGAATATACTGGCTGGGCAGGG + Intronic
1129816483 15:78558796-78558818 TGGAAAGTACTGCCTTGGGAAGG - Intergenic
1129855082 15:78818122-78818144 TGCAATTTACTGGGGTGGAAGGG - Intronic
1133088179 16:3381912-3381934 GGGAATTAATTGGATTGGGAAGG - Intronic
1136906514 16:34098087-34098109 TGGAAATGACTGGAATGGGATGG - Intergenic
1138030288 16:53554375-53554397 TGGAATCTACTTGTCTGGGATGG + Intergenic
1138750924 16:59420206-59420228 TGGAATTTGGGGACTTGGGAGGG - Intergenic
1138909672 16:61381056-61381078 TGGGAATTACTGCCCTGGGAGGG - Intergenic
1140006325 16:71079682-71079704 TGGCAGTAACTGACTTGGGATGG + Intronic
1141451607 16:84107286-84107308 TGGAGTTGACAGGCTTGGTAAGG - Intronic
1142161680 16:88560988-88561010 TGGAATGAAATGGCATGGGATGG + Intergenic
1144310681 17:14011450-14011472 ATGAATTTACTGGCTTCTGAAGG - Intergenic
1145080975 17:19894052-19894074 TGGAAAATACTGGCTTGGCCAGG + Intergenic
1145328626 17:21852199-21852221 TGGAATTGACTGGAATGGAATGG + Intergenic
1145329396 17:21858521-21858543 TGGAATTGACTGGAATGGAATGG + Intergenic
1145329866 17:21862421-21862443 TGGAATTGACTGGAATGGAATGG + Intergenic
1145330091 17:21864280-21864302 TGGAATGTACTCGATTGGCATGG + Intergenic
1145330388 17:21866958-21866980 TGGAATGGACTTGTTTGGGATGG + Intergenic
1145330613 17:21868867-21868889 TGGAATTGACTGGAATGGAATGG + Intergenic
1145331436 17:21875676-21875698 TGGAATTTACAGGAATGGAATGG + Intergenic
1145333233 17:21890515-21890537 TGGAATTTACTGGAATAGAATGG + Intergenic
1145333548 17:21893181-21893203 TGGAATGGACTGGAATGGGATGG + Intergenic
1145335554 17:21909464-21909486 TGGAATTCACTGGAATGGAATGG + Intergenic
1145337182 17:21922980-21923002 TGGAATATACTGGAATGGAATGG + Intergenic
1145337816 17:21927859-21927881 TGGAATTTACTGGAATGGAATGG + Intergenic
1145337820 17:21927889-21927911 TGGAATTGACTGGAGTGGAAAGG + Intergenic
1145338183 17:21930884-21930906 TGGAATTTACTGGAATGGAGTGG + Intergenic
1145339011 17:21937776-21937798 TGGAATTTAATGGATTCGAAAGG + Intergenic
1145339320 17:21940407-21940429 TGGAATTGACTGGAATGGAATGG + Intergenic
1145339424 17:21941242-21941264 TGGAATTGACTGGAATGGAACGG + Intergenic
1145340034 17:21946285-21946307 TGGAATTGACTGGTGTGGAAAGG + Intergenic
1145340271 17:21948295-21948317 TGTAATTGACTGGATTGGAATGG + Intergenic
1145340418 17:21949551-21949573 TGGAATATACTGGAATGGAATGG + Intergenic
1145341440 17:21958211-21958233 TGGAATTGAATGGATTGGAAAGG + Intergenic
1145344454 17:21980071-21980093 TGGAATTGATTGGAATGGGAAGG + Intergenic
1145695450 17:26783883-26783905 TGGAATTGACTGGAATGGAATGG + Intergenic
1145696672 17:26793866-26793888 TGGAATTGACTGGAATGGAATGG + Intergenic
1145697067 17:26797218-26797240 TGGAATTTACTGGAATGGAATGG + Intergenic
1145697401 17:26799869-26799891 TGGAATTGACTGGAATGGAATGG + Intergenic
1145698397 17:26808288-26808310 TGGAATGGACTGGATTGGAATGG + Intergenic
1145698996 17:26813440-26813462 TGGAATGTACTGGAATGGAATGG + Intergenic
1145699110 17:26814465-26814487 TGGAATGTACTGGAATGGAATGG + Intergenic
1145699166 17:26814923-26814945 TGGAATTTAATGGAATGGAATGG + Intergenic
1145699520 17:26817860-26817882 TGGAATTTAATGGCATGCAATGG + Intergenic
1145700443 17:26825713-26825735 TGGAATTGACTGGAATGGAATGG + Intergenic
1145700579 17:26826677-26826699 TGGAATGGAATGGCATGGGATGG + Intergenic
1145702378 17:26841626-26841648 TGGAATTGACTGGAGTGGAATGG + Intergenic
1145702787 17:26845155-26845177 TGGAATTGACTGGAGTGGAATGG + Intergenic
1145704136 17:26856516-26856538 TGGAATTTAATGGAATGGAATGG + Intergenic
1145705184 17:26865520-26865542 TGGAATTGACTGGAATGGAATGG + Intergenic
1145706052 17:26872441-26872463 TGGAATTGAATGGATTGGAATGG + Intergenic
1145706433 17:26875575-26875597 TGGAATTTAATGGTATGGAATGG + Intergenic
1145706494 17:26876017-26876039 TGGAATTGACTGGAGTGGAATGG + Intergenic
1145788274 17:27608226-27608248 TGGAATTGACTTGGTTGGGAAGG + Intronic
1146552613 17:33794678-33794700 TGGAATTTAATGGCCTCGGAGGG - Intronic
1147274143 17:39301050-39301072 TGGAATGTTCTGGCTCTGGATGG - Exonic
1147713199 17:42485138-42485160 TGGAAGTTACAGGCTGGGCACGG - Intronic
1148695536 17:49556026-49556048 TGGGATTTATTGGTTTGGGCAGG + Intergenic
1149699809 17:58645816-58645838 TGGATTTTACTGGTATGGGAGGG - Intronic
1150261190 17:63792496-63792518 CAGAATCTACTGGCTTGGAATGG - Exonic
1151045319 17:70913228-70913250 TGCAACATACTGGCTTGGAAAGG + Intergenic
1151243210 17:72774327-72774349 GAGAAATTAATGGCTTGGGAGGG + Intronic
1203174830 17_KI270729v1_random:1391-1413 TGGAATGAACTGGATTGGAATGG - Intergenic
1203176983 17_KI270729v1_random:26149-26171 TGGAATTCACTGGACTGGAATGG + Intergenic
1203177267 17_KI270729v1_random:28069-28091 TGGAATTTATTCGAATGGGATGG + Intergenic
1203177453 17_KI270729v1_random:29592-29614 TGGAATTTACTCGAATAGGATGG + Intergenic
1203177468 17_KI270729v1_random:29677-29699 TGGAATTTACTCGAACGGGATGG + Intergenic
1203177777 17_KI270729v1_random:32110-32132 TGGAATTGACTCGAATGGGATGG + Intergenic
1203178098 17_KI270729v1_random:34631-34653 TGGAATGTACTGGAATGGAATGG + Intergenic
1203178101 17_KI270729v1_random:34651-34673 TGGAATGTACTGGAATGGAAAGG + Intergenic
1203178105 17_KI270729v1_random:34691-34713 TGGAATATACTGGAATGGAAAGG + Intergenic
1203178149 17_KI270729v1_random:35024-35046 TGGAATGTACTGGAATGGAATGG + Intergenic
1203178270 17_KI270729v1_random:35946-35968 TGGAATTGAATGGATTGGAATGG + Intergenic
1203178916 17_KI270729v1_random:40936-40958 TGGAATTTACTCGAATGGAATGG + Intergenic
1203178985 17_KI270729v1_random:41481-41503 TGGAATTTACTCGAATGGGTTGG + Intergenic
1203179239 17_KI270729v1_random:43452-43474 TGGAATTTACTCGAATGGCATGG + Intergenic
1203179402 17_KI270729v1_random:44750-44772 TGGAATTTACTCGAATGGGATGG + Intergenic
1203179489 17_KI270729v1_random:45470-45492 TGGAATGTAATGGCTTCGAATGG + Intergenic
1203181058 17_KI270729v1_random:57139-57161 TGGAATATACTCGAATGGGATGG + Intergenic
1203181174 17_KI270729v1_random:58046-58068 TGGAATTTACTCGAATGTGATGG + Intergenic
1203181449 17_KI270729v1_random:60046-60068 TGGAATTTACTCGAATGGGACGG + Intergenic
1203181525 17_KI270729v1_random:60616-60638 TGGAATTTACTCGAATGGAATGG + Intergenic
1203181535 17_KI270729v1_random:60696-60718 TGGAATTTACTCGAATGGAACGG + Intergenic
1203193413 17_KI270729v1_random:210068-210090 TGGAATGTACTGGAGTGGAATGG + Intergenic
1203193918 17_KI270729v1_random:214363-214385 TGGAATGTACTGGAATGGAATGG + Intergenic
1203194575 17_KI270729v1_random:219765-219787 TGGAATGGACTGGCATGGAATGG + Intergenic
1203194649 17_KI270729v1_random:220389-220411 TGGAATTTACTGGAATGCAAAGG + Intergenic
1203195839 17_KI270729v1_random:230611-230633 TGGAATGGACTGGATTGGAATGG + Intergenic
1203196412 17_KI270729v1_random:236300-236322 TGGAATTGAATGGATTGGAATGG + Intergenic
1203196851 17_KI270729v1_random:240226-240248 TGGAATGTACTGGAGTGGAAGGG + Intergenic
1203196989 17_KI270729v1_random:241309-241331 TGGAATTTAATGGAATGGAATGG + Intergenic
1203197981 17_KI270729v1_random:249634-249656 TGGAATGTACTGGATTGGAATGG + Intergenic
1203199756 17_KI270729v1_random:264852-264874 TGGAATGTACTGGAATGGAATGG + Intergenic
1203200186 17_KI270729v1_random:268394-268416 TGGAATGGACTGGATTGGAATGG + Intergenic
1203200654 17_KI270729v1_random:272327-272349 TGGAATTGACTGGAATGGAATGG + Intergenic
1203200692 17_KI270729v1_random:272622-272644 TGGAATGGACTGGCGTGGAATGG + Intergenic
1203200955 17_KI270729v1_random:274833-274855 TGGACTTTACTGGAGTGGAATGG + Intergenic
1203202776 17_KI270730v1_random:9498-9520 TGGAATGTACTGGAGTGGAATGG + Intergenic
1203203282 17_KI270730v1_random:13793-13815 TGGAATGTACTGGAATGGAATGG + Intergenic
1203204004 17_KI270730v1_random:19785-19807 TGGAATTTACTGGAATGCAAAGG + Intergenic
1203205310 17_KI270730v1_random:30969-30991 TGGAATGGACTGGATTGGAATGG + Intergenic
1203206018 17_KI270730v1_random:37066-37088 TGGAATTGAATGGATTGGAATGG + Intergenic
1203206456 17_KI270730v1_random:40992-41014 TGGAATGTACTGGAGTGGAAGGG + Intergenic
1203206595 17_KI270730v1_random:42080-42102 TGGAATTTAATGGAATGGAATGG + Intergenic
1203207585 17_KI270730v1_random:50388-50410 TGGAATGTACTGGATTGGAATGG + Intergenic
1203209351 17_KI270730v1_random:65561-65583 TGGAATGTACTGGAATGGAATGG + Intergenic
1203209781 17_KI270730v1_random:69104-69126 TGGAATGGACTGGATTGGAATGG + Intergenic
1203210249 17_KI270730v1_random:73028-73050 TGGAATTGACTGGAATGGAATGG + Intergenic
1203210287 17_KI270730v1_random:73323-73345 TGGAATGGACTGGCGTGGAATGG + Intergenic
1203210550 17_KI270730v1_random:75534-75556 TGGACTTTACTGGAGTGGAATGG + Intergenic
1203211313 17_KI270730v1_random:81608-81630 TGGAATTGACTGGAGTGGAATGG + Intergenic
1203211710 17_KI270730v1_random:84440-84462 TGGAATTTAATGGAATGGAATGG + Intergenic
1203212659 17_KI270730v1_random:92845-92867 TGGAATGCACTGGGTTGGAATGG + Intergenic
1203213527 17_KI270730v1_random:102773-102795 TGGAATTTAATGGAATGGAATGG + Intergenic
1155329999 18:24705359-24705381 TGCTATTTACAGGCTTGGTATGG - Intergenic
1155498752 18:26466534-26466556 TGGAATTTGATGGGTAGGGAGGG + Intronic
1157634583 18:49138503-49138525 TGTAATTTACTGGTTTTGGTAGG + Intronic
1158780643 18:60646065-60646087 TGAAATTGAAAGGCTTGGGAAGG + Intergenic
1161912228 19:7202964-7202986 TGGAATGTATTGGTTTGGGGTGG + Intronic
1165949378 19:39465412-39465434 TGGTGTTTACTGGCGTAGGATGG + Intronic
1166369598 19:42293583-42293605 GGGAATTTGCTGGCCTGGGGTGG - Exonic
1167292120 19:48630130-48630152 TGGAATGTACTGGCTGGGGTAGG + Exonic
1168176539 19:54631441-54631463 TGGAATCTGCTGGGTTGGGTGGG + Intronic
925231281 2:2236113-2236135 TGGGATGTACTGGGTTGGGTTGG - Intronic
925231287 2:2236133-2236155 TGGGATGTACTGGGTTGGGTTGG - Intronic
925231316 2:2236233-2236255 TGGGATGTACTGGGTTGGGTTGG - Intronic
925231322 2:2236253-2236275 TGGGATGTACTGGGTTGGGTTGG - Intronic
925231340 2:2236313-2236335 TGGCATGTACTGGGTTGGGTTGG - Intronic
925231345 2:2236333-2236355 TGGGATGTACTGGGTTGGGTTGG - Intronic
925231381 2:2236453-2236475 TGGGATGTACTGGGTTGGGTTGG - Intronic
926300542 2:11599071-11599093 TGGAATTTAAGGGCTGGAGAAGG + Intronic
927305520 2:21567412-21567434 AAGAATTTACTGGGTTGGCAGGG - Intergenic
929052056 2:37845991-37846013 TGGATTTTAATGGCTATGGAGGG - Intergenic
929431585 2:41892200-41892222 TGAAATTGGCTGCCTTGGGAGGG + Intergenic
929806759 2:45153138-45153160 TGGAATTTCCTGGCTTCGGGAGG - Intergenic
929947484 2:46381864-46381886 TGGCACTTGCTGGCTTGGAAGGG - Intronic
931138265 2:59428627-59428649 TGACATTTTCTGGCTAGGGAGGG + Intergenic
932707422 2:74037517-74037539 TGGAGTTTACTGGCTTAGCAGGG + Intronic
933071528 2:77864573-77864595 TGGAATGCAGTGGCCTGGGATGG + Intergenic
933621971 2:84553758-84553780 TGGTATTTACAGGCTGGGCATGG - Intronic
934192569 2:89813137-89813159 TGGAATATACTGGAATGGAATGG - Intergenic
934195694 2:89836132-89836154 TGGAATTTAATGGAATGGAATGG + Intergenic
934196071 2:89838502-89838524 TGGAATTTATTGGAATGGAATGG + Intergenic
935413559 2:102790304-102790326 TGGATTTGAATGGCTTGGAATGG + Intronic
935661011 2:105467067-105467089 TGGCATTCATTGGCTTGTGAAGG - Intergenic
937915124 2:127095219-127095241 GGGATGTTAGTGGCTTGGGAGGG - Intronic
938737227 2:134197274-134197296 TGGAATTTTCTAGCTCAGGAAGG + Intronic
940168943 2:150805829-150805851 TGGAACTTAGTGGCTTAGCATGG - Intergenic
940696183 2:156982225-156982247 TGCAATTTAGAGGCTTGGGAGGG - Intergenic
941025715 2:160453948-160453970 TGAAACTTAGTGGGTTGGGAAGG - Intronic
947300045 2:228678883-228678905 TTGATTTTACTGCCTTGAGATGG - Intergenic
1168729158 20:61947-61969 TGGAATGGAGTGGCTTGGAATGG - Intergenic
1169309908 20:4527402-4527424 TGGGATTTACTGGAGTGGGCCGG - Intergenic
1171914617 20:31053727-31053749 TGGAATTTAATGGAATGGAATGG + Intergenic
1171915995 20:31062608-31062630 TGGAATTTAATGGAATGGAATGG + Intergenic
1171916240 20:31064183-31064205 TGGAATTTAATGGAATGGAATGG + Intergenic
1171916900 20:31068349-31068371 TGGAATGTAATGGCATGGAACGG + Intergenic
1171918135 20:31076110-31076132 TGGAATTTAATGGAATGGAATGG + Intergenic
1171918247 20:31076969-31076991 TGGAATGCACTGGATTGGAATGG + Intergenic
1171920134 20:31091873-31091895 TGGAATTTACTCGAATGGAATGG + Intergenic
1171920821 20:31097231-31097253 TGGAATTTAATGGATTCGAAAGG + Intergenic
1171922751 20:31164195-31164217 TGGAATTTAATGGAGTGGAATGG + Intergenic
1171923264 20:31168095-31168117 TGGAATGGACTGGATTGGAATGG + Intergenic
1171923475 20:31169865-31169887 TGGAATTTAATGGAATGGAATGG + Intergenic
1171923709 20:31171611-31171633 TGGAATGGACTGGATTGGAATGG + Intergenic
1171925092 20:31182665-31182687 TGGAATTTAATGGAATGGAAAGG + Intergenic
1171925995 20:31189090-31189112 TGGAATTTACTTGAATGGAATGG + Intergenic
1171926736 20:31195062-31195084 TGGAATGCACTGGATTGGAATGG + Intergenic
1171928633 20:31210037-31210059 TGGAATTTACTCGAATGGAATGG + Intergenic
1171929322 20:31215391-31215413 TGGAATTTAATGGATTCGAAAGG + Intergenic
1171931478 20:31233003-31233025 TGGAATGGACTGGATTGGAATGG + Intergenic
1171931976 20:31236971-31236993 TGGAATTCACTGGAATGGAAAGG + Intergenic
1171932128 20:31238144-31238166 TGGAATGTACTGGAATGGAATGG + Intergenic
1171932720 20:31242856-31242878 TGGAATGTACTGGATTGCAATGG + Intergenic
1172379543 20:34476630-34476652 TGGGATTTTCTGGCTTGAGTGGG + Intronic
1172430789 20:34889786-34889808 TGGAATTTGCTGACTTGGATTGG + Intronic
1172559070 20:35869810-35869832 GGAAATTTAATGGCTTAGGAAGG + Intronic
1173116418 20:40247716-40247738 TGGAATTTCCTGGTTTCGGGGGG - Intergenic
1175560693 20:59926756-59926778 TTGAATGTACTGGGTGGGGAAGG + Intronic
1175811409 20:61860428-61860450 TGCAGTTTTCTGGCCTGGGATGG + Intronic
1175918648 20:62439613-62439635 TGGAAGTTATAGGCCTGGGAAGG - Intergenic
1176527374 21:7930419-7930441 TGGAATTTAATGGAATGGAATGG - Intergenic
1176527905 21:7935020-7935042 TGGAATGGACTGGATTGGAACGG - Intergenic
1176527981 21:7935679-7935701 TGGAATGGAATGGATTGGGATGG - Intergenic
1176748396 21:10671666-10671688 TGGAATTCAATGGATTGGAATGG - Intergenic
1176748408 21:10671741-10671763 TGGAATTCAATGGATTGGAATGG - Intergenic
1176749334 21:10678475-10678497 TGGAATTTACTCGAATGGAATGG - Intergenic
1176749772 21:10681731-10681753 TGGAATGTACTGGAATGGAATGG - Intergenic
1176750126 21:10684590-10684612 TGGAATTTAATGGAATGGAACGG - Intergenic
1176753810 21:10710913-10710935 TGGAATTAATTGGAATGGGAAGG - Intergenic
1176754214 21:10713735-10713757 TGGAAATTAATGGCATGGAATGG - Intergenic
1176754719 21:10717376-10717398 TGGAATGCACTCGATTGGGATGG - Intergenic
1176754724 21:10717406-10717428 TGGAATTTACTGGAATGGAACGG - Intergenic
1176755797 21:10724744-10724766 TGGAATTGACTGGAATGGAAGGG - Intergenic
1176755818 21:10724899-10724921 TGGAATTTAATGGACTGGAATGG - Intergenic
1176756481 21:10729457-10729479 TGGAATATACTGGATTGGAATGG - Intergenic
1176756524 21:10729787-10729809 TGGAATTTAATGGACTGGAATGG - Intergenic
1176756953 21:10732641-10732663 TGGAATGTACTGGAATGGAATGG - Intergenic
1176757486 21:10736337-10736359 TGGAATTTAGTGGAGTGGAATGG - Intergenic
1176757624 21:10737345-10737367 TGGAATGTAATGGAATGGGAAGG - Intergenic
1178386575 21:32156345-32156367 GGGCATTTACTGGCTTGCTATGG - Intergenic
1178932938 21:36835502-36835524 TTGGATTTACAGGCTAGGGAGGG - Intronic
1180282719 22:10718047-10718069 TGGAATTTAATGGAATGGAATGG - Intergenic
1180282767 22:10718382-10718404 TGGAATGTAATGGATTGGAATGG - Intergenic
1180283381 22:10722840-10722862 TGGAATGTAATGGATTGGAATGG - Intergenic
1180283464 22:10723405-10723427 TGGAATTTAATGGAATGGAATGG - Intergenic
1180283514 22:10723740-10723762 TGGAATGTAATGGATTGGAATGG - Intergenic
1180530601 22:16347052-16347074 TGGAATTGACTGGAATGGAATGG + Intergenic
1180531890 22:16356350-16356372 TGGAATGTACTGGAATGGAATGG + Intergenic
1181515673 22:23410409-23410431 TGGTATTTGCTGTATTGGGAGGG + Intergenic
1183013717 22:34968984-34969006 TGCACTTAACTGGATTGGGAGGG - Intergenic
1183038583 22:35159263-35159285 TGCCATTTACTAGCTGGGGATGG + Intergenic
1183723273 22:39574456-39574478 TGGGCTTTAGGGGCTTGGGATGG + Intronic
1203297136 22_KI270736v1_random:51284-51306 TGGAATGTACTGGCGTGGAATGG + Intergenic
1203298226 22_KI270736v1_random:58871-58893 TGGAATTTAATGGAATGGAATGG + Intergenic
1203298500 22_KI270736v1_random:60709-60731 TGGAATGTACTGGAGTGGAATGG + Intergenic
1203298972 22_KI270736v1_random:63820-63842 TGGAATTGAATGGCTTGGAATGG + Intergenic
1203299953 22_KI270736v1_random:70105-70127 TGGAATTGAGTGGCATGGCATGG + Intergenic
1203301712 22_KI270736v1_random:81771-81793 TGGAGTTTAATGGCATGGAATGG + Intergenic
1203302227 22_KI270736v1_random:85146-85168 TGGAATTGAGTGGATTGGAATGG + Intergenic
1203302410 22_KI270736v1_random:86280-86302 TGGAATATACTGGATTGGAGTGG + Intergenic
1203302886 22_KI270736v1_random:89369-89391 TGGAATATACTGGAATGGAAAGG + Intergenic
1203303409 22_KI270736v1_random:92899-92921 TGGAATTTAATGGAATGGAATGG + Intergenic
1203305072 22_KI270736v1_random:103431-103453 TGGAATTTAATGGAATGGAAAGG + Intergenic
1203306412 22_KI270736v1_random:112323-112345 TGGAATTTAATGGAATGGAATGG + Intergenic
1203306606 22_KI270736v1_random:113596-113618 TGGAATGTAGTGGGTTGGCATGG + Intergenic
1203307057 22_KI270736v1_random:116541-116563 TGGAATGGAGTGGTTTGGGATGG + Intergenic
1203308020 22_KI270736v1_random:123166-123188 TGGAATTTAATGGAATGGAATGG + Intergenic
1203308145 22_KI270736v1_random:123949-123971 TGGAATTTAATGGAATGGAATGG + Intergenic
1203309204 22_KI270736v1_random:130776-130798 TGGAATGGACTGGATTGGAATGG + Intergenic
1203311228 22_KI270736v1_random:144204-144226 TGGAATTTAATGGAATGGAATGG + Intergenic
1203311433 22_KI270736v1_random:145597-145619 TGGAATTGAATGGATTGGAATGG + Intergenic
1203312010 22_KI270736v1_random:149341-149363 TGGAATTTAGTGGAATGGAATGG + Intergenic
1203312161 22_KI270736v1_random:150370-150392 TGGAATGGACTGGATTGGAATGG + Intergenic
1203312215 22_KI270736v1_random:150733-150755 TGGAATGGAGTGGCTTGGAATGG + Intergenic
1203312895 22_KI270736v1_random:155195-155217 TGGAATTTAATGGAGTGGAATGG + Intergenic
1203313112 22_KI270736v1_random:156656-156678 TGGAATTGAGTGGATTGGAAAGG + Intergenic
1203317752 22_KI270737v1_random:29437-29459 TGGAATGTACTGGAATGGAATGG - Intergenic
1203319046 22_KI270737v1_random:38760-38782 TGGAATTGACTGGAATGGAATGG - Intergenic
949643469 3:6066648-6066670 TGGAATTTGCTGGGCTGTGATGG - Intergenic
950475343 3:13211351-13211373 TGAAATTTACTGAATTAGGAAGG + Intergenic
950808988 3:15633209-15633231 TTGAAATTACTGGGGTGGGAGGG - Intronic
953654765 3:44841369-44841391 TTAAATTTACTGGCTGGGCATGG - Intronic
954055052 3:48016016-48016038 TGGAATTTCCAGGCTTGACAGGG + Intronic
958804451 3:98792826-98792848 TGTAATTTACTTGACTGGGAAGG + Intronic
960269167 3:115655909-115655931 TGGATTTTTCAGGCCTGGGATGG + Intronic
961434401 3:126906633-126906655 TGTAAATGACTGGCTAGGGAAGG - Intronic
961662924 3:128479910-128479932 TGGCATTTGCTGGCCTGGCAGGG - Exonic
961788120 3:129359507-129359529 TGAAATTTACTGAATTAGGAAGG - Intergenic
962030286 3:131592508-131592530 TGCAATTTACAGGCTTGGAGAGG + Intronic
962450680 3:135513987-135514009 TACAATTTAGTGGCTGGGGAGGG - Intergenic
964256584 3:154781402-154781424 TGTAGTTAACTGGATTGGGAAGG + Intergenic
965381287 3:167992137-167992159 AGTAATTTACTGTTTTGGGATGG + Intergenic
970911635 4:21283921-21283943 TGCAATTTACTGGCCGGGCACGG + Intronic
971878887 4:32342103-32342125 TGAAATTGACTTGCTTTGGAAGG - Intergenic
973350988 4:49102075-49102097 TGGAATGTAATGGATTGGAATGG - Intergenic
973351912 4:49107878-49107900 TGGAATGTAATGGATTGGAATGG - Intergenic
973352142 4:49109271-49109293 TGGAATGTAATGGATTGGAATGG - Intergenic
973352295 4:49110129-49110151 TGGAATGTAATGGATTGGAATGG - Intergenic
973352346 4:49110461-49110483 TGGAATTTAATGGAGTGGAATGG - Intergenic
973352430 4:49110966-49110988 TGGAATTTAATGGAATGGAATGG - Intergenic
973352672 4:49112460-49112482 TGGAATTTAATGGAGTGGAATGG - Intergenic
973352729 4:49112800-49112822 TGGAATTTAATGGAATGGAATGG - Intergenic
973353041 4:49114698-49114720 TGGAATTTATTGGAATGGTATGG - Intergenic
973353062 4:49114813-49114835 TGGAATTTAATGGAATGGAATGG - Intergenic
973353131 4:49115253-49115275 TGGAATTTAATGGAATGGAATGG - Intergenic
973353252 4:49116011-49116033 TGGAATTTAATGGAGTGGAAAGG - Intergenic
973353264 4:49116086-49116108 TGGAATTTAATGGAATGGAATGG - Intergenic
973353276 4:49116161-49116183 TGGAATTTAATGGAATGGAATGG - Intergenic
973353927 4:49120165-49120187 TGGAATGTAATGGATTGGAATGG - Intergenic
973354524 4:49123689-49123711 TGGAATTTAATGGAATGGAATGG - Intergenic
973354639 4:49124387-49124409 TGGAATTTATTGGAGTGGAATGG - Intergenic
973354661 4:49124512-49124534 TGGAATTTAATGGAATGGAATGG - Intergenic
973355943 4:49132174-49132196 TGGAATTTATTGGAGTGGAATGG - Intergenic
973355964 4:49132294-49132316 TGGAATTTAATGGAATGGAATGG - Intergenic
973356274 4:49134192-49134214 TGGAATTTAATGGAATGGAATGG - Intergenic
973356596 4:49136082-49136104 TGGAATTTAATGGAATGGAATGG - Intergenic
973356832 4:49137454-49137476 TGGAATTTACTGGAATGGAATGG - Intergenic
973357263 4:49139948-49139970 TGGAATTTACTGGAATGGAATGG - Intergenic
973357683 4:49142382-49142404 TGGAATTTACTGGAATGGAATGG - Intergenic
973358217 4:49145520-49145542 TGGAATTTAATGGAATGGAATGG - Intergenic
973358237 4:49145640-49145662 TGGAATTTAATGGAATGGAATGG - Intergenic
973358953 4:49149839-49149861 TGGAATTTAATGGAATGGAATGG - Intergenic
973400466 4:49634205-49634227 TGGAATTTAATGGAATGGAATGG + Intergenic
973400470 4:49634230-49634252 TGGAATTTAATGGAATGGAATGG + Intergenic
973401442 4:49640335-49640357 TGGAATTTAATGGAATGGAATGG + Intergenic
973401817 4:49642494-49642516 TGGAATTTAATGGAATGGAATGG + Intergenic
973402401 4:49646280-49646302 TGGAATTTAATGGAATGGAATGG + Intergenic
973402781 4:49648543-49648565 TGGAATTTAATGGAATGGAATGG + Intergenic
973404031 4:49656430-49656452 TGGAATGTAATGGAATGGGATGG + Intergenic
973719385 4:53707779-53707801 TGGAATATGCCGGCTGGGGAGGG + Intronic
974714994 4:65657548-65657570 TGGAATTAACTCGCTTTGGTTGG + Intronic
976564243 4:86535220-86535242 TGGAACTTTCTGGCTTTGGTAGG - Intronic
977082939 4:92556162-92556184 TAGAATTTATTGGCTTGTGAAGG - Intronic
978149686 4:105418158-105418180 CAGAATGTACTGGCTTGGAAAGG - Intronic
978594133 4:110358321-110358343 TGGTATTCAGTGCCTTGGGATGG + Intergenic
979383910 4:120041503-120041525 TGGAATTAACTGGGGTGGGGTGG + Intergenic
979995044 4:127421694-127421716 TGTAATTTATTAACTTGGGAGGG + Intergenic
981213398 4:142135498-142135520 TGGAAATGACTGGCTGGGGCTGG + Intronic
982222804 4:153139428-153139450 TAGAATTCACTGGCCTGAGAAGG - Intergenic
982684989 4:158477445-158477467 AGGAATTTACTGACTGAGGAGGG + Intronic
983484936 4:168322348-168322370 TGGAATTTACTGGGATTTGAGGG - Intergenic
985533387 5:447109-447131 AGGACTTCACTGGCTTGGGGTGG - Intronic
985782841 5:1880080-1880102 TGGACCTCTCTGGCTTGGGAAGG - Intronic
988296342 5:29367776-29367798 TGGAAATTAATATCTTGGGAAGG - Intergenic
989911578 5:49660198-49660220 TGGAATTTAATGGATTGGAATGG - Intergenic
990546889 5:56831367-56831389 TGGAGTTCACTGGTTTGCGATGG - Intronic
991650942 5:68852646-68852668 GGGAATTTATTGTCTTGGGTTGG - Intergenic
992419063 5:76583237-76583259 TTGAATTTAAATGCTTGGGAAGG + Intronic
992881661 5:81116371-81116393 TGGCATTCACTGGCTGGGTATGG - Intronic
993239426 5:85361609-85361631 TGGAACTTACGGGCTGGTGAGGG + Intergenic
994506080 5:100644515-100644537 TGAGATTTACTGACTTGGCATGG - Intergenic
994747034 5:103691180-103691202 AGAAATTTACTGTCTTGTGAAGG + Intergenic
995761759 5:115569845-115569867 TCTAATTTTCTGGCTTTGGAAGG + Intergenic
997470831 5:134115787-134115809 TGCAAGTTCCTGACTTGGGAAGG - Intronic
997884994 5:137621999-137622021 TGGATTCAACTTGCTTGGGAGGG - Exonic
999727700 5:154450478-154450500 TGGAATGTACTGTCCTGGGGAGG - Intronic
999866934 5:155711028-155711050 TGGAACCTACTGGCTGGGCATGG + Intergenic
1002687418 5:181024613-181024635 TGCCATTTGCTGGCTTGGGGTGG - Intergenic
1004946946 6:20625956-20625978 TAGAATTTAATGGCTGGGGATGG - Intronic
1005270976 6:24163365-24163387 TTTATTTTACTGGCCTGGGAGGG + Intergenic
1005398088 6:25404425-25404447 TGGAGTTTGCTGCCTTGGGAGGG + Intronic
1007946741 6:45833897-45833919 AGGAATCTATTGGCTTGTGATGG + Intergenic
1008456034 6:51711739-51711761 TGGTATTTGCTGGCTTTGGAGGG + Intronic
1008793743 6:55273755-55273777 TGGCATTTACTGGTCAGGGAAGG - Intronic
1011171880 6:84513810-84513832 TGGACTTTAGGGACTTGGGAGGG - Intergenic
1012510108 6:99992874-99992896 TGGAAATGACTGGATTGGGTTGG - Intronic
1015545858 6:134360592-134360614 TGGCATTTACTGACATGGGAAGG - Intergenic
1015587153 6:134788074-134788096 TGTAATTTAATTGGTTGGGATGG - Intergenic
1017020496 6:150136237-150136259 TGGCATTTTCTGTCTTGTGAGGG + Intergenic
1017529652 6:155276024-155276046 TGAAATGTACTCGCTTAGGAGGG + Exonic
1017762919 6:157584906-157584928 TGAAAAATACTGACTTGGGATGG + Intronic
1018503487 6:164439148-164439170 AGGAATTTAGTGGCTTGGGCAGG - Intergenic
1021585999 7:22209069-22209091 TTAGATTTACTGACTTGGGATGG + Intronic
1026224634 7:68429551-68429573 TGGAATTCACTCGCTTGGAAGGG + Intergenic
1027379141 7:77586833-77586855 TGGAATCTACTTTCTTGAGATGG - Intronic
1027517557 7:79161443-79161465 GGGCATTTACTGCCTTGTGATGG + Intronic
1027760241 7:82268781-82268803 TTGGATTTACTGTCTTGGAAAGG - Intronic
1028204596 7:88002136-88002158 AGGAATTTATTGACTTGTGACGG + Intronic
1029051822 7:97697593-97697615 TGGAATTTCCTTAGTTGGGAGGG - Intergenic
1029697178 7:102221125-102221147 TGGAATTTCCTGGCTTGGCATGG + Intronic
1031942878 7:127807910-127807932 TGGAATTTACTAGCGAGGGAAGG + Intronic
1033345098 7:140520330-140520352 CGGACTGTCCTGGCTTGGGAGGG + Intronic
1036199710 8:6758584-6758606 TGTATTTCACTGGCTTGAGAAGG - Exonic
1038541163 8:28391237-28391259 TGCAATTTACTGAAATGGGAAGG - Intronic
1039343099 8:36672561-36672583 TGGAATCTAATGGATTGGCATGG - Intergenic
1040486766 8:47880405-47880427 TGGAATTTTCTGCCATGCGAGGG - Intronic
1041128933 8:54675943-54675965 TGGCATTTGTTGTCTTGGGAGGG + Intergenic
1041177206 8:55209118-55209140 TGGAATTTACTGGCTTGGGATGG - Intronic
1041667904 8:60463776-60463798 AGGAATTTACTGGTTTTTGAGGG + Intergenic
1044106519 8:88214317-88214339 TGGAATTTGATGGATTGGAATGG - Intronic
1045140828 8:99280325-99280347 TTAAATTGAGTGGCTTGGGAGGG - Intronic
1045165765 8:99603095-99603117 TGGAATTTATTGGAATGAGAAGG + Intronic
1046743504 8:117852856-117852878 TGGAATTCACTGTCTTGCGTAGG + Intronic
1049246642 8:141566225-141566247 AGGAATCTTCTGGCTTGGGGTGG + Intergenic
1050120950 9:2306410-2306432 TGGAGTCTACTGGGTTGGAAGGG + Intergenic
1053468951 9:38331859-38331881 TGGCCTTTACTAGCTTGTGAAGG + Intergenic
1053506667 9:38649248-38649270 TGGAATTTACAGCCTAGTGAGGG + Intergenic
1055146911 9:72946758-72946780 AGCAATTATCTGGCTTGGGATGG - Intronic
1055302408 9:74896049-74896071 TGAAATTTACTGACATGGAAAGG + Intergenic
1055687515 9:78792922-78792944 TATAATTTACTTTCTTGGGATGG + Intergenic
1056699479 9:88890392-88890414 TGGAATTTACTGACTTCAGCTGG - Intergenic
1059333982 9:113557171-113557193 TGGAATTTACTGGGTTAGGGAGG + Intronic
1061002112 9:127908319-127908341 TGGAGTGTGATGGCTTGGGATGG + Exonic
1061149691 9:128821676-128821698 TGGAATCCACAGGCTCGGGATGG + Exonic
1203719351 Un_GL000216v2:2076-2098 TGGAATTTAGTGGAATGGAATGG - Intergenic
1203719823 Un_GL000216v2:5286-5308 TGGAATTGAATGGATTGGAATGG - Intergenic
1203719980 Un_GL000216v2:6405-6427 TGGAATCTAATGGATTGGAATGG - Intergenic
1203721996 Un_GL000216v2:20139-20161 TGGAATGTACTGGAATGGAATGG - Intergenic
1203722079 Un_GL000216v2:20831-20853 TGGAATTTCCTCGCATGGAATGG - Intergenic
1203723470 Un_GL000216v2:30609-30631 TGGAATTTCCTCGCATGGAATGG - Intergenic
1203723829 Un_GL000216v2:33437-33459 TGGAATGTACTGGAATGGAATGG - Intergenic
1203723956 Un_GL000216v2:34470-34492 TGGAATTTACTCGAATGCGATGG - Intergenic
1203724190 Un_GL000216v2:36434-36456 TGGAATTTAATGGAATGGAATGG - Intergenic
1203724444 Un_GL000216v2:38353-38375 TGGAATTGACTGGAATGGAAAGG - Intergenic
1203724451 Un_GL000216v2:38408-38430 TGGAATGTACTCGCATGGAATGG - Intergenic
1203724471 Un_GL000216v2:38572-38594 TGGAATTTACTAGAATGGAATGG - Intergenic
1203724698 Un_GL000216v2:40251-40273 TGGAATTAACTCGAATGGGAAGG - Intergenic
1203724744 Un_GL000216v2:40581-40603 TGGAATTTACTCGAATGGAATGG - Intergenic
1203724749 Un_GL000216v2:40611-40633 TGGAATTTAGTCGAATGGGATGG - Intergenic
1203725028 Un_GL000216v2:42665-42687 TGGAATGGAATGGCTTGGAATGG - Intergenic
1203725186 Un_GL000216v2:43894-43916 TGGAATTTACTCGAATGTGATGG - Intergenic
1203725293 Un_GL000216v2:44743-44765 TGGAATTTACTCGAATGGGATGG - Intergenic
1203725422 Un_GL000216v2:45786-45808 TGGAATTTACTTGAATGGAATGG - Intergenic
1203725645 Un_GL000216v2:47429-47451 TGGAATTTACTCGAATGGAATGG - Intergenic
1203725649 Un_GL000216v2:47459-47481 TGGAATTTACTCTAATGGGATGG - Intergenic
1203725742 Un_GL000216v2:48114-48136 TGGAATTTACTCGAATGGAATGG - Intergenic
1203726769 Un_GL000216v2:56163-56185 TGGAATGTACTGGAATGGAATGG - Intergenic
1203727434 Un_GL000216v2:61497-61519 TGGAATTTACTCGAATGGAATGG - Intergenic
1203728153 Un_GL000216v2:67510-67532 TGGAATTTAATGGATTGGAATGG - Intergenic
1203728470 Un_GL000216v2:70010-70032 TGGAATGTACTGGAATGGAATGG - Intergenic
1203728628 Un_GL000216v2:71246-71268 TGGAATTGACTCGCCTGGAATGG - Intergenic
1203729120 Un_GL000216v2:75051-75073 TGGAATGTAATGGATTGGAATGG - Intergenic
1203729598 Un_GL000216v2:78729-78751 TGGAATTTAATGGCATGGAATGG - Intergenic
1203386049 Un_KI270438v1:57073-57095 TGGAATTTACTGGAATGGAATGG + Intergenic
1203386070 Un_KI270438v1:57273-57295 TGGAGTTTAGTGGATTGGGATGG + Intergenic
1203386830 Un_KI270438v1:63627-63649 TGGAATCAACTGGAATGGGAAGG + Intergenic
1203389043 Un_KI270438v1:80676-80698 TGGAATGGACTGGATTGGAACGG + Intergenic
1203389147 Un_KI270438v1:81558-81580 TGGAATGTAATGGAATGGGATGG + Intergenic
1203389268 Un_KI270438v1:82623-82645 TGGAATGTACTGGATTTGAAAGG + Intergenic
1203389790 Un_KI270438v1:87106-87128 TGGAATTTAATGGAATGGAATGG + Intergenic
1203390338 Un_KI270438v1:91635-91657 TGGAATTGACTGGATTAGAACGG + Intergenic
1203343395 Un_KI270442v1:14285-14307 TGGAATGTACTGAATTGGAATGG + Intergenic
1203344190 Un_KI270442v1:19934-19956 TGGAATTGACTGGAATGGAATGG + Intergenic
1203344448 Un_KI270442v1:23485-23507 TGGAATGGACTGGAATGGGATGG + Intergenic
1203344601 Un_KI270442v1:24586-24608 TGGAATTGAATGGCATGGAATGG + Intergenic
1203345027 Un_KI270442v1:28007-28029 TGGAATGGACTGGCATGGAATGG + Intergenic
1203345392 Un_KI270442v1:30524-30546 TGGAATGGAATGGATTGGGAAGG + Intergenic
1203347627 Un_KI270442v1:46336-46358 TGGAATTTAATGGACTGGAATGG + Intergenic
1203347991 Un_KI270442v1:48850-48872 TGGAATTTAATGGAATGGAATGG + Intergenic
1203350318 Un_KI270442v1:76223-76245 TGGACTTTAATGGGATGGGATGG + Intergenic
1203351500 Un_KI270442v1:84944-84966 TGGAATTTAATGGAGTGGAATGG + Intergenic
1203352732 Un_KI270442v1:94621-94643 TGGAATTTAATGGAATGGAATGG + Intergenic
1203673997 Un_KI270756v1:6087-6109 TGGAATTGACTGGAGTGGAATGG - Intergenic
1203674946 Un_KI270756v1:14047-14069 TGGAATTGACTGGAGTGGAATGG - Intergenic
1203675514 Un_KI270756v1:18902-18924 TGGAATGGACTGGATTGGAATGG - Intergenic
1203676682 Un_KI270756v1:28554-28576 TGGAATGGACTGGATTGGAATGG - Intergenic
1203676900 Un_KI270756v1:30386-30408 TGGAATGTACTGGAGTGGAATGG - Intergenic
1203677201 Un_KI270756v1:32855-32877 TGGAATTTAATGGAATGGAAGGG - Intergenic
1203677223 Un_KI270756v1:33025-33047 TGGAATGGACTGGATTGGAATGG - Intergenic
1203677454 Un_KI270756v1:35034-35056 TGGAATGTACTGGAATGGAATGG - Intergenic
1203678826 Un_KI270756v1:46376-46398 TGGAATTGACTGGAATGGAATGG - Intergenic
1203680144 Un_KI270756v1:57118-57140 TGGAATTTAATGGAATGGAATGG - Intergenic
1203682107 Un_KI270756v1:73218-73240 TGGAATTTACTCGAATGGAATGG - Intergenic
1203682115 Un_KI270756v1:73288-73310 TGGAATTGACTGGAGTGGAATGG - Intergenic
1203683525 Un_KI270757v1:14845-14867 TGGAATGGAATGGATTGGGATGG + Intergenic
1188387328 X:29577362-29577384 TGGAATTAACAGGCTTGGGTAGG - Intronic
1189079788 X:37958932-37958954 TGGAATGTACTGGCGTGGGAGGG + Intronic
1196588214 X:117455394-117455416 TGGAATATGCTGTCTTTGGATGG - Intergenic
1197708109 X:129648296-129648318 TGGACCTTAATGGCTGGGGAGGG - Intronic
1197729732 X:129799254-129799276 CTGAATTTCCTGACTTGGGAGGG - Intergenic
1198296208 X:135289681-135289703 TGTATTTTACTGGTTTGAGAAGG - Intronic
1199367087 X:147000005-147000027 TGGCATTTACTGTCTTGCTATGG + Intergenic
1200412561 Y:2875981-2876003 TGGACTTTGTTGGCTTGGGTAGG + Intronic
1201096835 Y:10627938-10627960 TGGAATGTACTGGAGTGGAATGG - Intergenic
1201097656 Y:10646112-10646134 TGGAATGTACTGGAGTGGAATGG - Intergenic
1201097926 Y:10648021-10648043 TGGAGTTTAATGGATTGGAAAGG - Intergenic
1201098421 Y:10652954-10652976 TGGAATGTACTGGAATGGAATGG - Intergenic
1201101015 Y:10672780-10672802 TGGAATGGAATGGATTGGGATGG - Intergenic
1201105750 Y:10762139-10762161 TGGAATTTAATGGAATGGAATGG - Intergenic
1201106182 Y:10765070-10765092 TGGAATTTAATGGAATGGAATGG - Intergenic
1201106850 Y:10769765-10769787 TGGAATGTAATGGCATGGAATGG - Intergenic
1201109545 Y:10789229-10789251 TGGAATGGACTGGGATGGGATGG - Intergenic
1201110057 Y:10792692-10792714 TGGAGTTGACTGGATTGGAATGG - Intergenic
1201111089 Y:10800050-10800072 TGGAATTGAGTGGATTGGAATGG - Intergenic
1201113807 Y:10820418-10820440 TGGAATGGAATGGATTGGGAGGG - Intergenic
1201114235 Y:10823333-10823355 TGGAATTTAGTGGAGTGGCATGG - Intergenic
1201115191 Y:10830028-10830050 TGGAATTTAGTGGAATGGAATGG - Intergenic
1201115278 Y:10830689-10830711 TGGAATTTAGTGGAATGGAATGG - Intergenic
1201116799 Y:10841196-10841218 TGGAATGGAATGGATTGGGATGG - Intergenic
1201119715 Y:10863575-10863597 TGGAATGTAGTGGTTTGGAATGG - Intergenic
1201120161 Y:10866696-10866718 TGGAATTGACTGGAGTGGAATGG - Intergenic
1201121294 Y:10875540-10875562 TGGAATTTAATGGAATGGTATGG - Intergenic
1201121668 Y:10878144-10878166 TGGAATTGAGTGGCGTGGAATGG - Intergenic
1201121912 Y:10879761-10879783 TGGAATTGAGTGGCATGGAATGG - Intergenic
1201122494 Y:10883916-10883938 TGGAATTTAATGGAATGGAATGG - Intergenic
1201127182 Y:10925935-10925957 TGGAATGTAATGGATTGGAATGG - Intergenic
1201127431 Y:10927673-10927695 TGGAATTTAATGGAATGGAATGG - Intergenic
1201128604 Y:10935621-10935643 TGGAATTGAATGGATTGGAATGG - Intergenic
1201130242 Y:10946856-10946878 TGGAATGGACTGGATTGGAATGG - Intergenic
1201130639 Y:10949377-10949399 TGGAATGTACTGGATTGGAGTGG - Intergenic
1201134541 Y:10980581-10980603 TGGAATTTAGTGGAATGGAATGG - Intergenic
1201136667 Y:10995322-10995344 TGGAATCTAATGGATTGGAATGG - Intergenic
1201137611 Y:11001795-11001817 TGGAATTGAATGGCGTGGAATGG - Intergenic
1201141663 Y:11033561-11033583 TGGAATTTAATGGAATGGCATGG - Intergenic
1201174891 Y:11302434-11302456 CGGAATTTACTGGAATGGAATGG - Intergenic
1201196052 Y:11495611-11495633 TGGAATTTACTCGAATGGAATGG + Intergenic
1201196112 Y:11496160-11496182 TGGAATGTACTGGTATGGAATGG + Intergenic
1201197233 Y:11506287-11506309 TGGAATATACTGGAATGGAATGG + Intergenic
1201198383 Y:11516645-11516667 TGGAATGGACTGGATTGGAATGG + Intergenic
1201198929 Y:11521541-11521563 TGGAATTGACTGGATTTGAATGG + Intergenic
1201199512 Y:11526689-11526711 TGCAATTTACTGGAATGGAATGG + Intergenic
1201200576 Y:11536324-11536346 TGGAATTTAATGGAATGGAATGG + Intergenic
1201200817 Y:11538659-11538681 TGGAATTGACTCGATTGGAATGG + Intergenic
1201208410 Y:11654752-11654774 TGGAATTTAGTGGAATGGAACGG + Intergenic
1201211101 Y:11681312-11681334 TGGAATTTACTCGAATGGAATGG + Intergenic
1201211346 Y:11683643-11683665 TGGAATGTACTGGAATGGAATGG + Intergenic
1201211397 Y:11684039-11684061 TGGAATTTAGTGGAATGGAATGG + Intergenic
1201212725 Y:11695352-11695374 TGGAATGGACTGGAATGGGATGG + Intergenic
1201213436 Y:11701445-11701467 TGGAATTTAATGGAATGGAATGG + Intergenic
1201214408 Y:11709597-11709619 TGGAATTTAATGGAGTGGAATGG + Intergenic
1201214649 Y:11711736-11711758 TGGAATTGAATGACTTGGAATGG + Intergenic
1201214832 Y:11713364-11713386 TGGAAATTACTGGAATGGAATGG + Intergenic
1201215380 Y:11717999-11718021 TGGAATGTACTGGATTAGAATGG + Intergenic
1201216228 Y:11724973-11724995 TGGAATGTACTGGAGTGGAATGG + Intergenic
1201216473 Y:11727120-11727142 TGGAATTTAATGGAGTGGAATGG + Intergenic
1201216809 Y:11729923-11729945 TGGAATGGACTGGCATGGAATGG + Intergenic
1201217941 Y:11739492-11739514 TGGAATTGAATGGAATGGGAAGG + Intergenic
1201218086 Y:11740687-11740709 TGGAATTTAATGGAATGGAATGG + Intergenic
1201218148 Y:11741338-11741360 TGGAATGTACTGGATTGGAATGG + Intergenic
1201218767 Y:11746630-11746652 TGGAATGGACTGGAGTGGGATGG + Intergenic
1202053668 Y:20806722-20806744 TGGACTTTGTTGGCTTGGGTAGG + Intergenic
1202621832 Y:56771162-56771184 TGGAATGTAATGGAATGGGATGG + Intergenic
1202623109 Y:56832551-56832573 TGGAATTTAAGGGATTGGAATGG - Intergenic