ID: 1041177207

View in Genome Browser
Species Human (GRCh38)
Location 8:55209122-55209144
Sequence GAGCTGGAATTTACTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177207_1041177214 20 Left 1041177207 8:55209122-55209144 CCCAAGCCAGTAAATTCCAGCTC 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1041177214 8:55209165-55209187 CAATGAACGTGGCCCCAAAGAGG No data
1041177207_1041177215 21 Left 1041177207 8:55209122-55209144 CCCAAGCCAGTAAATTCCAGCTC 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1041177215 8:55209166-55209188 AATGAACGTGGCCCCAAAGAGGG No data
1041177207_1041177212 9 Left 1041177207 8:55209122-55209144 CCCAAGCCAGTAAATTCCAGCTC 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177207 Original CRISPR GAGCTGGAATTTACTGGCTT GGG (reversed) Intronic
901787519 1:11634529-11634551 GAGCTGGGAGTTAGGGGCTTGGG - Intergenic
901870714 1:12137767-12137789 GAGCTGGTACTTACAGACTTGGG + Intronic
902557826 1:17257324-17257346 GCCCTGGAAATTACAGGCTTTGG + Intronic
905570781 1:39003029-39003051 GGGCTGAAATTTCCTGGCTATGG + Intronic
905840313 1:41171018-41171040 GAGGTGCCATTTACTGGGTTGGG - Intronic
906079025 1:43071466-43071488 GTGCTGGAAGTTGCTGGTTTGGG + Intergenic
906662044 1:47589931-47589953 GGGCTGGCATTTACTGTCTGTGG + Intergenic
907418942 1:54333506-54333528 GTGCTGGGATTTACAGGCGTGGG - Intronic
908134337 1:61114899-61114921 AAGCTGGAATACACTGGCATAGG + Intronic
909579665 1:77219869-77219891 GCGCTGCAATTTAGAGGCTTGGG + Intergenic
911518243 1:98895360-98895382 GAGCAGAAATTTATTGGCTCAGG - Intronic
912149790 1:106844214-106844236 AAGCTGGAATTTCCTGGGTGAGG - Intergenic
912449931 1:109762408-109762430 GAGCTAGAATTTAAAGGGTTGGG - Intronic
913209649 1:116571665-116571687 GAGCTGGGATTTCCAGCCTTTGG + Intergenic
915090703 1:153422420-153422442 GAGCAAGAATTTACTTGATTTGG + Exonic
915355633 1:155254043-155254065 GAGCTGGAAAGAACTGGCTGGGG - Intronic
916769423 1:167893822-167893844 AAAATTGAATTTACTGGCTTTGG - Intronic
918898352 1:190378805-190378827 GATCTGGTATTTCCTGGCTTGGG + Intronic
919405907 1:197183496-197183518 GAGTTGACATTTACTGGGTTAGG - Intronic
922146226 1:222947959-222947981 GAGGTGGAATCTACTAGATTTGG + Intronic
1063588318 10:7372904-7372926 GAGCTGGAAGTTACTGACACAGG - Intronic
1063667441 10:8072258-8072280 TAGCTGTGATTTTCTGGCTTTGG + Intronic
1064513939 10:16125628-16125650 AAGCTGGAGTTGACTGGCCTTGG - Intergenic
1067942960 10:50671371-50671393 GAGCTGGCTTGTACTAGCTTGGG - Intergenic
1068629653 10:59286247-59286269 GTGCTGGGATTTACAGGCTTAGG - Intronic
1068768741 10:60796740-60796762 GAGATGAAATTTAATGGATTTGG + Intergenic
1069117914 10:64531325-64531347 CAGCTGAAATATACTGGTTTGGG - Intergenic
1070864203 10:79696332-79696354 GAGCTGGCTTGTACTGGCTTGGG - Intergenic
1071631102 10:87218558-87218580 GAGCTGGCTTGTACTGGCTTGGG - Intergenic
1075857534 10:125642826-125642848 CAGCTGGAATTTAATCGCATTGG + Intronic
1075968337 10:126631980-126632002 GAGCTGGAATACAGTGGCCTTGG + Intronic
1084025575 11:66446674-66446696 CAGCTTGATTTTACTGGGTTTGG + Intronic
1085118178 11:73948980-73949002 GAGCTGGCTTGTACTGGCTTGGG + Intergenic
1086208155 11:84285249-84285271 GAGCTGGGATTTACTGGATGAGG - Intronic
1087066653 11:94033749-94033771 GAGTTGGTGTTTAATGGCTTTGG - Intronic
1088165481 11:106930808-106930830 GTGCTGGGATTTACAGGCATGGG - Intronic
1092326326 12:7534926-7534948 GAGCTGGCATTGACTGTCTGTGG - Intergenic
1092947655 12:13471892-13471914 GAGCTGGAACTTAGTGGGTGAGG + Intergenic
1093572943 12:20689569-20689591 GGGGTAGAATTTACAGGCTTGGG - Intergenic
1093742926 12:22708555-22708577 GAGATAGAATGTCCTGGCTTGGG + Intergenic
1094609249 12:31977449-31977471 GTGCTGGGATTTACAGGCGTGGG + Intronic
1097141506 12:56906137-56906159 GAGCACTAATTGACTGGCTTAGG + Intergenic
1101045314 12:100799476-100799498 GTGCTGGGATTTACAGGCATGGG - Intronic
1101073258 12:101098602-101098624 GAACAGAAAATTACTGGCTTTGG - Intronic
1103588701 12:121975062-121975084 GAAATGGAATTTTCTGGTTTGGG + Intronic
1106278355 13:28237573-28237595 AAGCTGGAATTTACCGGTTCGGG + Intronic
1106635630 13:31525689-31525711 CATCTGGAAATTACTGGGTTGGG - Intergenic
1107057007 13:36116947-36116969 TACCTGGAAGTCACTGGCTTAGG + Intronic
1108808493 13:54189294-54189316 GAGCTAGAATTTACTAGATCTGG - Intergenic
1118069069 14:62225179-62225201 GAGTTGGAAAATACTGCCTTTGG - Intergenic
1120499192 14:85273213-85273235 GTGTTTGATTTTACTGGCTTAGG - Intergenic
1121236583 14:92395729-92395751 GAGCTGGAATTTGCTTGACTTGG + Intronic
1122268662 14:100558505-100558527 GAGATGGTATTTGCTGGCTAGGG - Intronic
1122440877 14:101731084-101731106 GAGCAGGAATTCTCTAGCTTTGG + Intronic
1124062421 15:26306454-26306476 GAGCTGGTATTGAGTGTCTTTGG - Intergenic
1129785690 15:78308680-78308702 GAGCAGGAATTCACTGCCTCCGG - Intergenic
1129939308 15:79479864-79479886 GAGCTGGGATGTGCTGGTTTGGG - Intergenic
1135406892 16:22205096-22205118 AAGCTGGAGTTTACTCTCTTTGG + Intergenic
1138150039 16:54648487-54648509 AAGAGGGAATTTAGTGGCTTAGG + Intergenic
1139922766 16:70470350-70470372 GAGCAGGAACTCACTGGCTGAGG - Exonic
1146552615 17:33794682-33794704 AGGCTGGAATTTAATGGCCTCGG - Intronic
1147988851 17:44321364-44321386 GAGCTGGGACTGACTGGGTTTGG + Intronic
1148338262 17:46856157-46856179 AAGCTGGGATTCACTGTCTTGGG - Intronic
1151833345 17:76568748-76568770 CAGCTTGAATTTACTGGCAGAGG + Exonic
1153198332 18:2625016-2625038 AAGCAAGAATTCACTGGCTTGGG + Intergenic
1154122903 18:11665875-11665897 CAGTTGCAATTAACTGGCTTAGG + Intergenic
1155284023 18:24270947-24270969 GTGCTGGATTTTTCTGGGTTTGG - Intronic
1157006723 18:43591052-43591074 GATCTGGAATTTATTTCCTTGGG + Intergenic
1157903786 18:51547226-51547248 CATTTGGAATTTACTGTCTTAGG + Intergenic
1159438662 18:68449535-68449557 GAGCAAGAATTTATTGGCTTGGG - Intergenic
1165155924 19:33787568-33787590 GTGCTGGAATGTGCTGGCTTGGG - Intergenic
1165875988 19:39007280-39007302 CATCTGGAATTGACTGCCTTGGG - Intronic
1167243313 19:48358509-48358531 GAGCTGCCATTTACTGGGATGGG - Intronic
1167292118 19:48630126-48630148 GACCTGGAATGTACTGGCTGGGG + Exonic
1168176537 19:54631437-54631459 GAGCTGGAATCTGCTGGGTTGGG + Intronic
927827358 2:26317884-26317906 GAGCTGGACATTGCTGGCTGGGG + Intronic
928214074 2:29346716-29346738 GAGTTTGGATTTACTGGCTCAGG + Intronic
928482005 2:31692629-31692651 GAGATGGAAGTCACTGGGTTAGG - Intergenic
928918029 2:36494797-36494819 CAGCAGGAATTCACTGTCTTTGG - Intronic
929806761 2:45153142-45153164 TCTCTGGAATTTCCTGGCTTCGG - Intergenic
931141328 2:59461518-59461540 GCTCTGGAATTCACTGTCTTTGG + Intergenic
932193599 2:69763243-69763265 GAGCTGGAACTTGATGACTTCGG + Intronic
933433937 2:82220754-82220776 GAGCAGGAAATGACTGGCATGGG - Intergenic
935309212 2:101766561-101766583 AAGCTGGAAATTGGTGGCTTAGG - Intronic
936373104 2:111919388-111919410 GGGCTTGAATTTATTGGCTCAGG - Intronic
936768935 2:115888282-115888304 GAGCTGGAGGTTAGTAGCTTTGG - Intergenic
937702640 2:124881465-124881487 GAGCCCGAGTTTACTGACTTGGG + Intronic
939017317 2:136917896-136917918 TAGCTGAAATATACTGGCTTAGG + Intronic
940937560 2:159514649-159514671 GCTCTGGTATTTACTGGCTAAGG + Intronic
943283375 2:185965501-185965523 GACCTGGAACTTACTGTCTTAGG - Intergenic
943781868 2:191832992-191833014 GAGCAGGAATTAACTGGACTTGG + Intergenic
944256788 2:197630878-197630900 CAGCTGGAATTTATTTCCTTAGG + Intronic
946039892 2:216774464-216774486 GAGCTGGAATTGCCTGCCTCGGG + Intergenic
946146876 2:217737775-217737797 GAGCTGGAATATACTGGAGCAGG - Intronic
946885704 2:224220372-224220394 GAGATAGAATTAACTGGCTCCGG + Intergenic
947722293 2:232377577-232377599 GAGCTGGAATCTTTTGGTTTTGG - Intergenic
1168881250 20:1207940-1207962 GGGGTGAAATTGACTGGCTTCGG - Exonic
1169309909 20:4527406-4527428 GTGCTGGGATTTACTGGAGTGGG - Intergenic
1170126348 20:12968417-12968439 GAACTCTAATTTACTAGCTTCGG + Intergenic
1171297516 20:24031605-24031627 GAGATGGAATTTGCTGTGTTTGG + Intergenic
1173724386 20:45287127-45287149 GAGCTGGCATTCACTGGGTGAGG - Intergenic
1176268366 20:64222441-64222463 GGCCTGGAATGTACTGCCTTAGG + Intronic
1176410438 21:6446911-6446933 AAGGTGGAATTTCCTGCCTTGGG + Intergenic
1176756497 21:10729601-10729623 GGACTGGAATTTAATGGATTGGG - Intergenic
1178380147 21:32100796-32100818 GAGTTGGATTTTACTGTGTTGGG - Intergenic
1179685931 21:43055233-43055255 AAGGTGGAATTTCCTGCCTTGGG + Intronic
1180783918 22:18536470-18536492 GAGCAAGAATTTACTGGCACAGG + Intergenic
1181127485 22:20710519-20710541 GAGCAAGAATTTACTGGCACAGG + Intronic
1183281542 22:36935213-36935235 GCTCTGGAACTTACTGCCTTGGG - Intronic
1184591346 22:45485528-45485550 GGCCTGGAAATTCCTGGCTTTGG + Intergenic
950230919 3:11275102-11275124 GAGGTGGAATTTGCTGGACTTGG + Intronic
950962640 3:17121633-17121655 CAGTTAGAATTTACTGGCTCAGG - Intergenic
956005358 3:64772921-64772943 GAAATGGAATTGAATGGCTTAGG + Intergenic
956498175 3:69851216-69851238 GAGCTGGATTTTATTGACATAGG + Intronic
960226146 3:115171598-115171620 GCGCTGGAATTTCTTGGGTTAGG - Intergenic
961761477 3:129172241-129172263 GTGATGGAATTTACAGGGTTAGG + Intronic
962126640 3:132626402-132626424 AAGCTGAAACTTACTGCCTTAGG + Intronic
963160950 3:142149893-142149915 GAGCTGGGGTTTTCTGGCTTCGG - Intergenic
964343288 3:155730918-155730940 GTTCTGGATTTTACTGGGTTGGG - Intronic
964955958 3:162356101-162356123 GTCCTGGACTTTACTGGCTCTGG + Intergenic
965662493 3:171056424-171056446 GAGCTGCCATTTACTGGCACAGG + Intergenic
967251861 3:187547958-187547980 GAGCTGAAATTCACTTGATTTGG - Intergenic
971436642 4:26633108-26633130 TAGCAGGAATTTACTGCTTTGGG + Intronic
971878888 4:32342107-32342129 GAGGTGAAATTGACTTGCTTTGG - Intergenic
972793067 4:42391444-42391466 GAGCTGTAATTTATTAACTTGGG - Intergenic
973636841 4:52868923-52868945 GAGATGAAATTTACCTGCTTAGG + Intergenic
973695354 4:53485237-53485259 GAGCTCGAATTTGCTCTCTTTGG + Intronic
974247761 4:59343024-59343046 GAGGTGGAAATTACTAGTTTAGG + Intergenic
977146897 4:93453752-93453774 CAGGTGGAATTTTCTGACTTTGG + Intronic
977858634 4:101927633-101927655 GCAATGGAATTTACTGACTTTGG + Intronic
978350136 4:107812659-107812681 ATGCTGGAATTTACTGCTTTAGG + Intergenic
978560660 4:110030309-110030331 GAGATGGAATGGAGTGGCTTGGG + Intergenic
980598570 4:134988536-134988558 GAGCTGGCATTTAGTGTCTGTGG - Intergenic
984541928 4:181049758-181049780 GAGCTGGAATTTACAATCTGTGG - Intergenic
984818742 4:183861552-183861574 GAGTTGGAACACACTGGCTTGGG + Intronic
985097404 4:186427018-186427040 GAGCTGGCTTGTCCTGGCTTTGG + Exonic
986807075 5:11318093-11318115 GAGCTGCATTCTACTGACTTTGG + Intronic
988626871 5:32886417-32886439 TACCTGGAATTTACTGCTTTTGG + Intergenic
989536322 5:42568166-42568188 GAGCAGGGATTTTCTTGCTTGGG + Intronic
991086018 5:62648873-62648895 TGGCTTGAATTTACTGGATTGGG + Intergenic
991499995 5:67267610-67267632 GACCTGGTCTTTTCTGGCTTGGG + Intergenic
991650943 5:68852650-68852672 CAGCGGGAATTTATTGTCTTGGG - Intergenic
993453808 5:88104425-88104447 GAGATGGAATTGACTGGAATTGG + Intergenic
993656449 5:90583990-90584012 GAGCTGGACTCTGATGGCTTGGG + Intronic
994046296 5:95314137-95314159 GATCTGGAATTTACTGAGATGGG + Intergenic
995357801 5:111259522-111259544 GATCAGGAATTTACTGTCTTTGG + Intronic
998353406 5:141515495-141515517 AAGCTGCAATTCTCTGGCTTAGG - Exonic
1000347631 5:160328122-160328144 AACCTGGAATTTAGTGGCTGAGG + Intronic
1003505724 6:6738705-6738727 GTGCTGGAATTGATAGGCTTCGG - Intergenic
1005939286 6:30548641-30548663 GAGCTGGATTTTACAGGGTTGGG - Intronic
1008072468 6:47111784-47111806 GAGCTGGCATTTATTTGCATTGG - Intergenic
1008456032 6:51711735-51711757 GTTCTGGTATTTGCTGGCTTTGG + Intronic
1009216113 6:60921968-60921990 AATCTGGAATATACTGGCTGCGG - Intergenic
1015874312 6:137807714-137807736 GAGCTGGGATTCAATGTCTTTGG - Intergenic
1018503488 6:164439152-164439174 GGGAAGGAATTTAGTGGCTTGGG - Intergenic
1021000453 7:15324325-15324347 GATCTGGAACTTACAGGATTGGG - Intronic
1021804729 7:24343593-24343615 GAGCAGGGATTTACTGGATGAGG - Intergenic
1021805339 7:24349402-24349424 GAGCAGGGATTTACTGGATGAGG + Intergenic
1022394801 7:29977633-29977655 GAGCTGGAATTCACTGGCTGTGG - Intronic
1023227109 7:37982364-37982386 GAGCTGGTATTTACTGAAATAGG + Intronic
1023374215 7:39539955-39539977 GAGCTGGAATTGATGGGCTATGG - Intergenic
1026546662 7:71329015-71329037 AAGGTGGAATTTAATGACTTGGG + Intronic
1027140140 7:75650910-75650932 CAGCAGCAATTTACTGGCCTTGG + Intronic
1028277821 7:88879617-88879639 GAGTTGGAATTTACTGACCCTGG - Intronic
1032801202 7:135318482-135318504 GAGCTGGTATTTGCTTGCTTTGG - Intergenic
1034061411 7:148094613-148094635 GAGCTGGAATTGACAGAATTTGG + Intronic
1034241714 7:149616209-149616231 GAGCGGCCATTTACTGGGTTGGG + Intergenic
1035008174 7:155685842-155685864 AAACTGATATTTACTGGCTTAGG + Intronic
1035575067 8:699125-699147 GAGCTGATATTTAGTGGGTTTGG - Intronic
1036730754 8:11262024-11262046 TAGCTGCAAATTACTGCCTTGGG - Intergenic
1037353076 8:17984024-17984046 GAACTGAAATTTATTAGCTTTGG - Intronic
1037414665 8:18636995-18637017 AGGCTGGAATGTGCTGGCTTAGG - Intronic
1041177207 8:55209122-55209144 GAGCTGGAATTTACTGGCTTGGG - Intronic
1041618905 8:59941891-59941913 CGGCTGGAATTTACCAGCTTCGG - Intergenic
1041826657 8:62102330-62102352 GACCTGGAACTTATTGTCTTAGG - Intergenic
1042481571 8:69309388-69309410 GAGCTGGAAAACAGTGGCTTAGG + Intergenic
1043387286 8:79760807-79760829 TTGCTGGGATTTACAGGCTTGGG + Intergenic
1043425142 8:80141205-80141227 TAGCTGGAATTTAGGGGATTAGG - Intronic
1043519886 8:81033691-81033713 GAACTGGAGTTCACTTGCTTGGG - Intronic
1044216640 8:89619619-89619641 GAGTTTGAATTGACTGGATTTGG - Intergenic
1045326588 8:101121933-101121955 GAGCTGGATTTCACTTCCTTTGG - Intergenic
1045420847 8:102013525-102013547 GTGCTGGAATTCACTGGCCAGGG + Intronic
1046478433 8:114780722-114780744 GAGATGGAATTTACTTCCTGGGG + Intergenic
1047201237 8:122769688-122769710 GAGCTGAAATTGGCTGACTTTGG + Intergenic
1047806817 8:128369749-128369771 GACCTGAAATTAACTAGCTTAGG + Intergenic
1047887125 8:129263850-129263872 GATATGGACTTTACTGTCTTTGG + Intergenic
1049130073 8:140831578-140831600 GAGGAGGAATTCATTGGCTTAGG - Intronic
1051295802 9:15594683-15594705 GATTTGGAAGTTACTGACTTAGG + Intronic
1051504125 9:17809129-17809151 GAGTTGGAATTAAGTGGCTTTGG + Intergenic
1054797108 9:69312912-69312934 GAGCTGGCATTGAGTGTCTTTGG + Intergenic
1054869232 9:70034107-70034129 GAGCTGTGATTTACTGGATTAGG + Intergenic
1056291771 9:85150679-85150701 GAGCTAGAATTCACTGGCTCAGG - Intergenic
1057878075 9:98772769-98772791 GAGCTGGGATTTGCAGGCTGTGG - Intronic
1059333980 9:113557167-113557189 TAAATGGAATTTACTGGGTTAGG + Intronic
1059885939 9:118744605-118744627 GAGGTGGAATTGATTGGCTTTGG + Intergenic
1060538625 9:124413743-124413765 GGACTTGAAGTTACTGGCTTAGG + Intronic
1185759834 X:2681953-2681975 GACCTTGAATTTACTGATTTTGG - Intergenic
1186356318 X:8794811-8794833 GGGTTGGAATTTCCTGGGTTGGG - Intronic
1186619572 X:11224584-11224606 GGGTTGGAATTTCCTGGGTTGGG + Intronic
1186722993 X:12326073-12326095 GCCCTGGAAATTACTGGCTATGG + Intronic
1186795109 X:13039541-13039563 GGGTTGGAATTTCCTGGGTTGGG - Intronic
1190044176 X:47099225-47099247 GGGCTGGAAGTGACTGGGTTAGG - Intergenic
1190477959 X:50846997-50847019 GAGCTCTAATTAATTGGCTTAGG - Intergenic
1192860039 X:75057983-75058005 TATCAGGAAATTACTGGCTTTGG - Intronic
1193051822 X:77110177-77110199 GTGCTGGCATTTTATGGCTTAGG + Intergenic
1193058758 X:77182215-77182237 GAGCTGGAATTGAGTGCCTGTGG - Intergenic
1193352799 X:80482010-80482032 GACCTGGAATTCACTGTCTTAGG + Intergenic
1193669794 X:84370235-84370257 GGACTGGAATTTACTGGACTTGG + Intronic
1195479013 X:105321291-105321313 GAGGGGAAATTTACTGGCCTAGG + Intronic
1196095905 X:111799655-111799677 TAGCAGGAATTTACTGTTTTGGG - Intronic
1196695424 X:118606595-118606617 GTGCTGGAAGTTTCTGGCTTTGG + Intronic
1198596506 X:138241732-138241754 AATCTGGAATGTACTGGATTTGG + Intergenic
1199478294 X:148270330-148270352 TAGCTAGAATTTACAGCCTTGGG + Intergenic
1199691941 X:150315152-150315174 GAGCTGGGTTTCACTGGGTTAGG - Intergenic
1200020718 X:153204360-153204382 GGGTTGGAATTTTCTGGGTTGGG + Intergenic
1201609797 Y:15828220-15828242 TAGCTGGGATTTACAGGCATCGG + Intergenic