ID: 1041177208

View in Genome Browser
Species Human (GRCh38)
Location 8:55209123-55209145
Sequence AGAGCTGGAATTTACTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177208_1041177214 19 Left 1041177208 8:55209123-55209145 CCAAGCCAGTAAATTCCAGCTCT 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1041177214 8:55209165-55209187 CAATGAACGTGGCCCCAAAGAGG No data
1041177208_1041177215 20 Left 1041177208 8:55209123-55209145 CCAAGCCAGTAAATTCCAGCTCT 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1041177215 8:55209166-55209188 AATGAACGTGGCCCCAAAGAGGG No data
1041177208_1041177212 8 Left 1041177208 8:55209123-55209145 CCAAGCCAGTAAATTCCAGCTCT 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177208 Original CRISPR AGAGCTGGAATTTACTGGCT TGG (reversed) Intronic
900494614 1:2970898-2970920 AGGGCTGGGAATCACTGGCTGGG - Intergenic
901554971 1:10024462-10024484 AGGGCTGGAGTATACTGGCATGG - Intergenic
901790926 1:11653507-11653529 AGAGCTGGAATTTTCAGGGCTGG + Intronic
902722515 1:18313369-18313391 AGAGCTGGGATTCAGAGGCTAGG - Intronic
904028107 1:27517599-27517621 AGAGCAGGAGTTTAAGGGCTGGG + Intergenic
905281532 1:36852495-36852517 AGAGCTGAAGTTTAATGACTTGG + Intronic
906981287 1:50632723-50632745 AGAGCTGGAAACCACTGTCTGGG - Intronic
907418943 1:54333507-54333529 AGTGCTGGGATTTACAGGCGTGG - Intronic
915355634 1:155254044-155254066 AGAGCTGGAAAGAACTGGCTGGG - Intronic
918898351 1:190378804-190378826 AGATCTGGTATTTCCTGGCTTGG + Intronic
920319752 1:205110313-205110335 AGAACTGGTAGGTACTGGCTGGG - Intronic
921582110 1:216907081-216907103 AGAGCTGGAATATTCTGAGTAGG + Intronic
922288569 1:224191090-224191112 AGAGCTGGAGTTTCCTGGATGGG + Intronic
922663085 1:227447303-227447325 AGGACTGGGATTTACCGGCTGGG - Intergenic
1063653430 10:7963313-7963335 AAAGATGGCATTTACTGGTTAGG + Intronic
1063849273 10:10165936-10165958 ATAGCTGGAATTCACTGATTGGG + Intergenic
1064638417 10:17391665-17391687 ATAGCTGCAATATACTGGCCTGG + Intronic
1065676290 10:28177939-28177961 AGACCTGGAATCTGCTGCCTGGG - Intronic
1067294934 10:44970160-44970182 AGACCTAGAAGTTACTTGCTGGG - Exonic
1068063666 10:52101723-52101745 AGCTCTGGAAGCTACTGGCTAGG - Intronic
1069119405 10:64550359-64550381 AGAGCTGGAATTTCCTGGGTAGG - Intergenic
1069811852 10:71166712-71166734 AGACCTGGGATCCACTGGCTAGG - Intergenic
1070483270 10:76906087-76906109 AGAACTGCTGTTTACTGGCTGGG - Intronic
1070864204 10:79696333-79696355 GGAGCTGGCTTGTACTGGCTTGG - Intergenic
1071631103 10:87218559-87218581 GGAGCTGGCTTGTACTGGCTTGG - Intergenic
1073391988 10:103186617-103186639 AAAAATGGCATTTACTGGCTGGG + Intronic
1073560506 10:104492468-104492490 TGAACTGCAGTTTACTGGCTTGG + Intergenic
1079028232 11:16965857-16965879 AGAGCTGGAATGTGCTGGGCAGG - Intronic
1080244695 11:30166519-30166541 AGACCTGTAGTCTACTGGCTTGG - Intergenic
1081319862 11:41678994-41679016 AGAGCTTAAATATACAGGCTAGG + Intergenic
1085118177 11:73948979-73949001 GGAGCTGGCTTGTACTGGCTTGG + Intergenic
1087771911 11:102220071-102220093 AGACATGGACTTCACTGGCTGGG + Intronic
1088165482 11:106930809-106930831 AGTGCTGGGATTTACAGGCATGG - Intronic
1091028657 11:132163766-132163788 AGAGCTGAGAATCACTGGCTAGG - Intronic
1092920551 12:13227870-13227892 AGAGTGGGAATTTATTGGCAAGG + Intergenic
1093742925 12:22708554-22708576 AGAGATAGAATGTCCTGGCTTGG + Intergenic
1094116456 12:26919832-26919854 AGATCTGGAATTTAGGGGCCGGG + Intronic
1094609248 12:31977448-31977470 AGTGCTGGGATTTACAGGCGTGG + Intronic
1096010595 12:48210847-48210869 AGAACTGGCCTTTTCTGGCTGGG - Intergenic
1096543447 12:52321470-52321492 ATAGCTGAATTTTATTGGCTTGG + Intergenic
1097052032 12:56229437-56229459 AGAAATGGCAGTTACTGGCTGGG + Exonic
1101045315 12:100799477-100799499 AGTGCTGGGATTTACAGGCATGG - Intronic
1101585631 12:106083123-106083145 AGTGCTGGAGTTTACTTGCACGG - Intronic
1101808552 12:108087558-108087580 AGATGTGGAATTTGCTGGATTGG + Intergenic
1102333178 12:112053310-112053332 AAAACTGGTATTTACTGACTAGG - Intronic
1106192893 13:27469379-27469401 AGAAATGGACTTTTCTGGCTGGG - Intergenic
1106278354 13:28237572-28237594 AAAGCTGGAATTTACCGGTTCGG + Intronic
1108052178 13:46456624-46456646 AGAGTTGGCAGTTACTGGCATGG + Intergenic
1110163716 13:72411164-72411186 AGAGCTAGAACTTGCTGGCTAGG - Intergenic
1111977291 13:94979771-94979793 AGAGAAGGAATTTATTGGCTTGG + Intergenic
1112923649 13:104646500-104646522 AAGGCTGGAGTTTACTGTCTAGG - Intergenic
1113101428 13:106723973-106723995 AAAGCTGGAAGGTACTGGCAAGG - Intergenic
1115034549 14:28841080-28841102 AGAGATGGAGATTAGTGGCTGGG - Intergenic
1117057531 14:51928291-51928313 AGTGCTGGAAATTACAGGCGCGG + Intronic
1121148657 14:91609347-91609369 TGAATTGCAATTTACTGGCTAGG + Intronic
1122268663 14:100558506-100558528 AGAGATGGTATTTGCTGGCTAGG - Intronic
1125714259 15:41810302-41810324 AGAGCTGGTATTTAGGGGCCTGG + Intronic
1126076212 15:44912684-44912706 ATAGCTGGTATTCACTTGCTTGG + Intergenic
1126082631 15:44980317-44980339 ACAGCTGGTATTCACTTGCTTGG - Intergenic
1126099287 15:45110216-45110238 AGGGCTGAAATTTGGTGGCTGGG - Intronic
1128241536 15:66104752-66104774 AGAGATGGAATTCACCTGCTCGG - Intronic
1129277154 15:74453510-74453532 AGAGCTGATATTTACTGGGGGGG + Intronic
1129947658 15:79554663-79554685 AGACCTGGAACTGAATGGCTGGG - Intergenic
1129987205 15:79928607-79928629 AGAGCTGCCATTTACTGGAATGG - Intergenic
1131622319 15:94081174-94081196 AGAGCTGGTATTTATTAGGTTGG - Intergenic
1132743255 16:1426380-1426402 AGAGCTGGAAGGTACAGGCAGGG + Intergenic
1137987521 16:53122516-53122538 AAAGTTGGAAATTGCTGGCTGGG + Intronic
1138445935 16:57063675-57063697 AAAGCTGGGACTTTCTGGCTGGG - Intronic
1138836394 16:60441284-60441306 AGAGCTGGAATTGTGTGGTTGGG + Intergenic
1139502244 16:67376647-67376669 AGAGCTGGTAGTTACTGACTAGG + Intronic
1143308692 17:5970525-5970547 AGAGATAGGATTTACTGTCTTGG - Intronic
1146612681 17:34321550-34321572 AGAGCTGGAACATCCTGGCCTGG - Intergenic
1148338263 17:46856158-46856180 AAAGCTGGGATTCACTGTCTTGG - Intronic
1150976407 17:70091920-70091942 AGAGCTGTAATTTATTGGGTTGG + Intronic
1151957945 17:77389736-77389758 AGAGGAAGAATTTCCTGGCTGGG - Intronic
1152039297 17:77892696-77892718 GGAACTTGAATGTACTGGCTAGG + Intergenic
1152271764 17:79329092-79329114 AGGGCTGGGATTTAGTGGGTGGG - Intronic
1153652214 18:7250944-7250966 AGAACTGCAATTAACTGGCAGGG - Intergenic
1154136216 18:11781265-11781287 AGAGCTGTAGTTTAATGGTTAGG - Intronic
1157526911 18:48390617-48390639 AGGGCTGGAATTTACTCTCGAGG - Intronic
1158611626 18:58945678-58945700 AGAACTGAGATTTACTAGCTAGG - Intronic
1159438663 18:68449536-68449558 CGAGCAAGAATTTATTGGCTTGG - Intergenic
1161265773 19:3363675-3363697 AGATCTTGAATTTCCTTGCTGGG + Intronic
1165155925 19:33787569-33787591 GGTGCTGGAATGTGCTGGCTTGG - Intergenic
1167292117 19:48630125-48630147 GGACCTGGAATGTACTGGCTGGG + Exonic
1168176536 19:54631436-54631458 AGAGCTGGAATCTGCTGGGTTGG + Intronic
925681118 2:6422142-6422164 TGAGAGGGAATTTTCTGGCTTGG + Intergenic
926149530 2:10417018-10417040 AGAGCTGGGCTTAACTGGCCAGG + Intronic
927387760 2:22555679-22555701 AGAGGTGGCATATACTGGGTGGG + Intergenic
927827357 2:26317883-26317905 GGAGCTGGACATTGCTGGCTGGG + Intronic
928420737 2:31136539-31136561 AGAGATAGAATTTACTCTCTGGG - Intronic
928471202 2:31578354-31578376 AGATCTGGAGTCTACTGCCTGGG + Intronic
929852206 2:45602750-45602772 AGAAATGGAATTAACTGGGTTGG - Intronic
929947486 2:46381869-46381891 AGGGCTGGCACTTGCTGGCTTGG - Intronic
930988601 2:57621885-57621907 AAAGATTGATTTTACTGGCTAGG - Intergenic
931591624 2:63889702-63889724 GGAGCTGGACTTTAGTGGATAGG - Intronic
933433938 2:82220755-82220777 AGAGCAGGAAATGACTGGCATGG - Intergenic
936165072 2:110114187-110114209 AGAACAGGCATTTACAGGCTGGG - Intronic
940129709 2:150367196-150367218 AGAACTGGAGTTCACTTGCTGGG + Intergenic
945324773 2:208470190-208470212 AGATCTTGAATTTACCGGTTAGG + Intronic
946010125 2:216557849-216557871 AGAGATGCAATTTAGTGGCTAGG - Intronic
946039891 2:216774463-216774485 GGAGCTGGAATTGCCTGCCTCGG + Intergenic
946741954 2:222811558-222811580 ACAACTGGATTTTACTGACTTGG - Intergenic
1169903772 20:10579858-10579880 AAAGCTGGCATTTACTAGTTAGG + Intronic
1172063696 20:32204995-32205017 AGAGCTGCCACTTACTGGCTGGG + Intronic
1173622176 20:44445136-44445158 AGAGTTGGAGTTGTCTGGCTGGG - Intergenic
1175569898 20:60010582-60010604 TGAGCTGGAGTTTGCTGGGTTGG + Intronic
1176410437 21:6446910-6446932 AAAGGTGGAATTTCCTGCCTTGG + Intergenic
1178748653 21:35279416-35279438 ACAACTGGAATTTACTTTCTAGG - Intronic
1179338800 21:40484915-40484937 AGAGCAGGAAGCTACAGGCTGGG - Intronic
1179685930 21:43055232-43055254 AAAGGTGGAATTTCCTGCCTTGG + Intronic
1180019113 21:45109441-45109463 TGACCTGGATTTTAATGGCTTGG + Intronic
1182720094 22:32390741-32390763 AGATTTGGAATATACTGGCCAGG - Intronic
1183796348 22:40121600-40121622 ACAGCTGGCATTTGCTTGCTAGG + Intronic
949749854 3:7339281-7339303 AGAGCTGGCACCTACTGTCTTGG - Intronic
950005503 3:9688660-9688682 AGATCTGGAATTTACTGCTCCGG + Intronic
950160371 3:10756193-10756215 AGAGCTGCAATTCACAGCCTTGG - Intergenic
950330086 3:12149266-12149288 AGAGCTGGCATTAACTCCCTAGG + Intronic
953095610 3:39772072-39772094 AAAGCTGGGATTTACTTTCTGGG + Intergenic
954639629 3:52090278-52090300 GGAGCAGGAATTTCATGGCTCGG + Intronic
956157956 3:66318075-66318097 AGAGCTAAAATCCACTGGCTTGG - Intronic
957157533 3:76564570-76564592 AGAGCAGGAAGTCAATGGCTGGG + Intronic
960200701 3:114832148-114832170 AGGACAGGATTTTACTGGCTTGG - Intronic
962030285 3:131592503-131592525 ACAGGTGCAATTTACAGGCTTGG + Intronic
965835605 3:172848498-172848520 AGCTCTGCTATTTACTGGCTGGG + Intergenic
967610398 3:191499285-191499307 AGAGCTGCAATCTACAGCCTAGG - Intergenic
967962854 3:194939617-194939639 AGAGCTGGAATCTGCTGGGATGG + Intergenic
969368785 4:6717166-6717188 AGAGCTGGAAGACACAGGCTGGG - Exonic
970911634 4:21283916-21283938 AAATCTGCAATTTACTGGCCGGG + Intronic
971054496 4:22897323-22897345 AGAGCTTGCATGTGCTGGCTTGG + Intergenic
971743413 4:30549531-30549553 AGGGCTGGAATTAGCTAGCTAGG - Intergenic
972793068 4:42391445-42391467 AGAGCTGTAATTTATTAACTTGG - Intergenic
973741961 4:53927009-53927031 AGAGTTTAAATATACTGGCTGGG + Intronic
977391606 4:96416445-96416467 AGTGCTGGGATTTACTTGCAAGG + Intergenic
978256473 4:106698248-106698270 AGTTCTGCCATTTACTGGCTAGG + Intergenic
978318584 4:107467623-107467645 AGAGCTGGAAATTGCTGCCCAGG + Intergenic
979618175 4:122768219-122768241 AGAGCTGGAAGATATTAGCTAGG - Intergenic
982084828 4:151823836-151823858 AGAGGTGGAAATTACTCTCTTGG - Intergenic
984490115 4:180423744-180423766 AGAGCTTGCAATTATTGGCTTGG - Intergenic
985424145 4:189812085-189812107 AGAGCTGGCTTGCACTGGCTAGG + Intergenic
991499994 5:67267609-67267631 AGACCTGGTCTTTTCTGGCTTGG + Intergenic
991714601 5:69439456-69439478 AGAACTATAAATTACTGGCTGGG + Intronic
992881662 5:81116376-81116398 AGAAATGGCATTCACTGGCTGGG - Intronic
993656448 5:90583989-90584011 AGAGCTGGACTCTGATGGCTTGG + Intronic
994273127 5:97805957-97805979 AGAGCTCTAATTAATTGGCTTGG - Intergenic
996422319 5:123276492-123276514 AGAACTGAAAACTACTGGCTCGG - Intergenic
996786923 5:127247826-127247848 AAAGCTGGAATTTGCAGGGTAGG + Intergenic
997122065 5:131184866-131184888 GGAGCTGGAATTAACTGCCATGG - Intronic
997267662 5:132505301-132505323 ATACCTGGAATTGAATGGCTAGG - Intergenic
1001767449 5:174261991-174262013 AGTGCTGCCATTTCCTGGCTGGG + Intergenic
1002488520 5:179556793-179556815 AGAGATGCAATTCATTGGCTGGG - Intronic
1004637342 6:17481856-17481878 AGAGCTGGTATTTAATGACATGG - Intronic
1005939287 6:30548642-30548664 AGAGCTGGATTTTACAGGGTTGG - Intronic
1011055705 6:83201284-83201306 ATAGCTGGTATGTACTGGCATGG + Intergenic
1011536152 6:88378492-88378514 TGGGCTGGAATTCACTGGCTGGG + Intergenic
1012213088 6:96548405-96548427 AAATCTGGAATTTGGTGGCTAGG - Intronic
1012246170 6:96928223-96928245 AGTGCTGGAACTTGATGGCTGGG + Intronic
1015695056 6:135970773-135970795 AGGGCTGGAAATTAGTGGTTTGG + Intronic
1015838219 6:137445412-137445434 AGATATGGAATGTAATGGCTAGG - Intergenic
1017767989 6:157622682-157622704 AGAGCTGGGAGATACTGACTAGG - Intronic
1018503489 6:164439153-164439175 AGGGAAGGAATTTAGTGGCTTGG - Intergenic
1018653600 6:166011144-166011166 ACAGCTGGAAATCACTGGCCCGG - Intergenic
1019982372 7:4630876-4630898 AAAGCTGGAATTTATAGGCTGGG - Intergenic
1020463961 7:8455508-8455530 TGAGCTGAAATGTCCTGGCTAGG - Intronic
1022144975 7:27528169-27528191 AGAGCTGCCATTCAGTGGCTGGG - Intronic
1024332728 7:48172388-48172410 AGAGATAGAATATTCTGGCTCGG - Intronic
1026511864 7:71034060-71034082 AGAGCTGGGATTAAATGGCCTGG + Intergenic
1033348206 7:140541511-140541533 AGAGGTGGAATTCTCAGGCTTGG - Intronic
1036693312 8:10958488-10958510 AGAGCTGGATATCACTGGCAAGG + Intronic
1038478291 8:27884310-27884332 AGAGCTGGAATTCAGAGGCTGGG + Intronic
1040432460 8:47357158-47357180 AGAGTGTGAATTTATTGGCTAGG + Intronic
1041177208 8:55209123-55209145 AGAGCTGGAATTTACTGGCTTGG - Intronic
1041855713 8:62452178-62452200 AAAACTAGAATTTACTGGCTGGG + Intronic
1045420846 8:102013524-102013546 TGTGCTGGAATTCACTGGCCAGG + Intronic
1046478432 8:114780721-114780743 TGAGATGGAATTTACTTCCTGGG + Intergenic
1048307779 8:133296043-133296065 GGAGCTGGGATTTAGTGGGTCGG - Intronic
1052991201 9:34520327-34520349 AGAGCTGGATTTCCCTGGCCTGG + Intronic
1055680888 9:78714058-78714080 AGAGCTTGAATTTGCTAACTGGG + Intergenic
1056449478 9:86701980-86702002 ATCTCTGGTATTTACTGGCTGGG - Intergenic
1058009821 9:99964687-99964709 AGAGCTTGATTTCACAGGCTGGG + Intronic
1186356319 X:8794812-8794834 AGGGTTGGAATTTCCTGGGTTGG - Intronic
1186378063 X:9029041-9029063 AGGGTTGGAATTTCCTGGGTCGG - Intronic
1186619571 X:11224583-11224605 AGGGTTGGAATTTCCTGGGTTGG + Intronic
1186638375 X:11428955-11428977 AGGGGTGGAATTTGCTGGATTGG - Intronic
1186795110 X:13039542-13039564 AGGGTTGGAATTTCCTGGGTTGG - Intronic
1186942840 X:14529498-14529520 AGTGCTGAAATTTATAGGCTGGG + Intronic
1187146778 X:16644431-16644453 AGAGCCTCAATTTACAGGCTGGG - Intronic
1190901909 X:54683508-54683530 AAAGATGGAATTTAATGGCTTGG - Intergenic
1191939464 X:66462793-66462815 AGGCCTGGAACTTTCTGGCTTGG - Intergenic
1192200381 X:69062793-69062815 AGTGCTGCTATTTATTGGCTGGG - Intergenic
1193532728 X:82675712-82675734 AGAGCTGGAATTTATTAGGTTGG - Intergenic
1196722274 X:118865568-118865590 AGAGGTGGAGTTTGCTGGATGGG - Intergenic
1199659101 X:150029449-150029471 ATAGCTGCAATTTGCTTGCTTGG - Intergenic
1200014885 X:153152392-153152414 AGAGTTGGATTTTTCTGGGTTGG + Intergenic
1200020717 X:153204359-153204381 AGGGTTGGAATTTTCTGGGTTGG + Intergenic