ID: 1041177209

View in Genome Browser
Species Human (GRCh38)
Location 8:55209128-55209150
Sequence AGGTCAGAGCTGGAATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177209_1041177215 15 Left 1041177209 8:55209128-55209150 CCAGTAAATTCCAGCTCTGACCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1041177215 8:55209166-55209188 AATGAACGTGGCCCCAAAGAGGG No data
1041177209_1041177214 14 Left 1041177209 8:55209128-55209150 CCAGTAAATTCCAGCTCTGACCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1041177214 8:55209165-55209187 CAATGAACGTGGCCCCAAAGAGG No data
1041177209_1041177212 3 Left 1041177209 8:55209128-55209150 CCAGTAAATTCCAGCTCTGACCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177209 Original CRISPR AGGTCAGAGCTGGAATTTAC TGG (reversed) Intronic
900926114 1:5707170-5707192 AGGTGACAGCTGGCATTTGCTGG + Intergenic
900927432 1:5714403-5714425 AGGCCAGAGCTGGAGCTTCCAGG - Intergenic
903267046 1:22163785-22163807 AGGTCAGCTCTGGAATATTCCGG + Intergenic
903279531 1:22242605-22242627 AGGTCAGAGGTGGCAGTGACAGG + Intergenic
903383131 1:22910282-22910304 AGGTCAGACGTGCAATGTACTGG + Intronic
904965644 1:34370332-34370354 AGGCCAGAGGTGCAATTAACAGG - Intergenic
908214942 1:61942106-61942128 AGGTCAAAGCTGAACTTTGCAGG + Intronic
910362043 1:86422666-86422688 AGGACACAGCTGGAATTTGAAGG + Intergenic
911561195 1:99407638-99407660 ACGTCAGTGCTGCGATTTACTGG - Intergenic
913161302 1:116148337-116148359 AGGGCAGAGCTGGATTTTAAAGG - Intergenic
916442725 1:164843365-164843387 AGGTCATAGCTGGCATATCCTGG + Intronic
917720172 1:177779673-177779695 AGGGCAGAGGTGGGATTTCCTGG - Intergenic
919853727 1:201691585-201691607 AGCTCAGAGGTGGAATGAACAGG + Intronic
1064805179 10:19122485-19122507 AGCTCAGAGCTAGAATGTTCAGG + Intronic
1065969850 10:30797641-30797663 AGATCAGAGCGACAATTTACTGG + Intergenic
1066364428 10:34763110-34763132 AGGTCACTGCTGGTATTTAGTGG + Intronic
1067031988 10:42884449-42884471 AGGGGAGAGCTGGGATTTAAGGG + Intergenic
1073923078 10:108481307-108481329 AGGTCAGGGGTGGAATTTTATGG + Intergenic
1076145115 10:128112725-128112747 TGCTCACAGCTGGTATTTACTGG - Intronic
1077285199 11:1762489-1762511 AGGTCATAGCTGGCTTTTCCTGG + Intronic
1077425125 11:2472453-2472475 AGGGCAGAGCTGGAAAGAACTGG + Intronic
1077430072 11:2511926-2511948 AGGTCAGAGCGGGCATGGACAGG + Intronic
1084277484 11:68061622-68061644 AGGTCAGAGCTGGACTTCGAGGG + Intronic
1086208156 11:84285255-84285277 TGGGCGGAGCTGGGATTTACTGG - Intronic
1089149240 11:116352042-116352064 AGTTCAGAACTGGCATTTAGAGG - Intergenic
1089376980 11:118001254-118001276 AAGTCAGAGCTAGAATTTCGGGG - Exonic
1090960681 11:131553818-131553840 AGGTAAGAACTTGACTTTACAGG - Intronic
1092931370 12:13318861-13318883 AAGGCAGAGCTGGAATCAACAGG + Intergenic
1094739901 12:33276355-33276377 ATGACAGTGTTGGAATTTACCGG - Intergenic
1099806358 12:87525145-87525167 AGGTCAGAGTTGGGATTGAGTGG - Intergenic
1100996717 12:100308751-100308773 AGGTCAGAACTGGAGTTTCTTGG - Intronic
1102212388 12:111136831-111136853 AAGTCAGTGCAGGAACTTACAGG + Intronic
1102843998 12:116158128-116158150 AGGTCAGAGCAGAAATTCAAGGG + Intronic
1104652748 12:130548497-130548519 AGATCAGAGATGGAATTTTAAGG - Intronic
1105049974 12:133040168-133040190 AGCTCAGAGCTCAAATTTATTGG - Intronic
1105329376 13:19400833-19400855 AGGTCAGAGTTGGAAAAGACTGG + Intergenic
1105746267 13:23379492-23379514 AGGCCAGTGCTGGAAAATACAGG + Intronic
1106681778 13:32015886-32015908 GGGTTAGAGCTGGAATTAAGAGG + Intergenic
1107199361 13:37695356-37695378 AGGGCATTGCTGGAATGTACTGG - Intronic
1109362980 13:61320895-61320917 GGGTCAGAGATGGGAATTACAGG + Intergenic
1112266098 13:97925249-97925271 AGGAAAGAGTTGGAATTTTCTGG - Intergenic
1113036156 13:106052058-106052080 AGGTGTTAGCTGGAATTAACGGG + Intergenic
1115182645 14:30647371-30647393 AGCTCAGGGCTGGAAATTAAGGG - Intronic
1116032687 14:39591610-39591632 AAGTCAGACTTGGAATTCACTGG + Intergenic
1118918204 14:70126074-70126096 AGGTAAGAGCTGGACTCTGCTGG - Intronic
1120427619 14:84369738-84369760 AGGAAAGAGCTTGCATTTACAGG + Intergenic
1121448576 14:93993751-93993773 AGGACAGAGCTGCAATTAAATGG - Intergenic
1122323050 14:100866977-100866999 AGGTCAGGTCTGGAGTTTACAGG - Intergenic
1125369913 15:38963502-38963524 AGGTCGGAGCAGGGATTGACTGG - Intergenic
1129118559 15:73380588-73380610 AGGTCAGAGCTGGAGTTTCTAGG - Intergenic
1131761578 15:95628511-95628533 AGGTGGGAGCTGAATTTTACCGG + Intergenic
1132031589 15:98442732-98442754 AGGTCAGAACTGCAGTTTGCTGG + Intronic
1132408108 15:101556966-101556988 AGGACAGAGCTGGAATTCTGAGG + Intergenic
1132575836 16:663625-663647 AGGCCAGAGCTGGGCCTTACAGG - Intronic
1132642548 16:984412-984434 TGGCCAGAGCTGGGGTTTACAGG - Intronic
1132743253 16:1426375-1426397 GGGGCAGAGCTGGAAGGTACAGG + Intergenic
1133643193 16:7737812-7737834 AGAGCAGGGCTGGAATTTCCAGG + Intergenic
1138021661 16:53488530-53488552 AGGTGATAGCTGAAACTTACGGG + Intronic
1138038324 16:53631412-53631434 AGGTGAGAACGGGAAATTACAGG - Intronic
1139059232 16:63228427-63228449 AGGAAAGAGCTAGAAATTACAGG - Intergenic
1139434040 16:66926011-66926033 AGGTCTGAGCTAGAATTTAGGGG + Intergenic
1140487152 16:75302695-75302717 AGGACAGAGCTGCGAGTTACTGG + Intronic
1141032822 16:80604347-80604369 AGGGCAGAGCTGGAAGTTGGGGG + Exonic
1142966906 17:3587291-3587313 AGGTCAGAGGTTGCGTTTACAGG - Intronic
1143308913 17:5972144-5972166 AGGCCAGAGCTGGAAGAGACAGG - Intronic
1145001007 17:19304601-19304623 AGGACAGGGCTGGAATCCACAGG + Intronic
1145057041 17:19709460-19709482 AGTACAGAGCTGGAATAGACCGG + Intronic
1150854136 17:68734366-68734388 AGGTTAGAGCAGAAGTTTACTGG - Intergenic
1150976405 17:70091915-70091937 GGGTGAGAGCTGTAATTTATTGG + Intronic
1151137839 17:71964790-71964812 AGGTCAGAGCTGCTAATGACTGG + Intergenic
1153964703 18:10168701-10168723 TTGTCAGAGCGAGAATTTACCGG - Intergenic
1157167020 18:45366924-45366946 AGGGCAGGGCTGGGACTTACTGG + Intronic
1157284622 18:46369299-46369321 TGGCCTGAGCTGGGATTTACTGG + Intronic
1158498507 18:57978859-57978881 AGGTCAGGGCTGGAAGCCACTGG - Intergenic
1164676368 19:30104271-30104293 GGGAGAGAGCTGGAATCTACAGG - Intergenic
1166181739 19:41113620-41113642 AGGGCAGAGCTGGAAGCCACAGG - Intergenic
1167266118 19:48483563-48483585 AGGTGAGAGCTGGACTTTCTGGG - Intergenic
926347604 2:11962695-11962717 AGGTCAGAGGTGGAATTTCTTGG - Intergenic
932125546 2:69142514-69142536 AGTTCAGTGGTGGTATTTACTGG + Intronic
933320385 2:80768745-80768767 AGGTCAGAGATGTAAAATACGGG - Intergenic
933469148 2:82698313-82698335 AGGACAGAGCTCAAAATTACTGG + Intergenic
934040088 2:88121017-88121039 AAGTCAGAGTTGGGAGTTACAGG - Intergenic
934710626 2:96511879-96511901 TGGTAAGAGCAGGTATTTACTGG - Intergenic
936432111 2:112473655-112473677 TGGGCATAGCTGGGATTTACAGG + Intergenic
942124248 2:172807581-172807603 AATTTAGTGCTGGAATTTACTGG - Intronic
944131566 2:196353057-196353079 AGGTCAGAGCTGTAATTGGAGGG - Intronic
944866167 2:203864703-203864725 AAGACAGAGGTGCAATTTACTGG - Intergenic
946448447 2:219759638-219759660 GGTTCAGAGCTGGGTTTTACTGG + Intergenic
946767896 2:223057081-223057103 CGGTCAGAGCAGCATTTTACAGG - Intronic
948103132 2:235391239-235391261 AGGTGAGAGCTGGAACCTAGAGG + Intergenic
1169892361 20:10466751-10466773 AGGGGAGGGCTGGAATTTAGGGG + Intronic
1174230293 20:49040789-49040811 AGGTCAAAGATGGAATTCTCAGG + Intergenic
1176270654 20:64234312-64234334 AGGTCAGGGCTGCAAAGTACCGG + Intronic
1178147063 21:29752218-29752240 AGGTCAGAGCTAGAATGGGCTGG + Intronic
1178489085 21:33036506-33036528 AGGTCAGAGCTGGAACTGATGGG - Intergenic
1181464477 22:23103474-23103496 GGGTCAGAGCTGGGAGTCACTGG - Intronic
1185078700 22:48697078-48697100 AGTTCTGAGCTGTAATCTACTGG + Intronic
949329848 3:2909481-2909503 AGCACAGAACTGGGATTTACTGG - Intronic
949643471 3:6066658-6066680 TGGGCAGATCTGGAATTTGCTGG - Intergenic
950636948 3:14322193-14322215 AGGTTAGAACTGGAATTTTGTGG - Intergenic
951656394 3:25013708-25013730 AAGTGAGAGCTGGAATTGAGAGG + Intergenic
954658865 3:52215697-52215719 ACTTCAGAGGTGGAACTTACAGG - Intergenic
956336555 3:68170678-68170700 AGGGCAGAGCTGTAAACTACTGG + Intronic
956651521 3:71508808-71508830 GGGTCAGAGCTGGAATTCCAAGG - Intronic
957814938 3:85285120-85285142 AGGACAAAGCTGCTATTTACTGG + Intronic
958686032 3:97395939-97395961 AGGACATAGTTGGAAGTTACAGG + Intronic
959312172 3:104752855-104752877 AGGTCAAAGTTGGATTGTACTGG - Intergenic
959441066 3:106376186-106376208 AGGTGGGAGCTGGAATTGCCTGG + Intergenic
960523765 3:118685336-118685358 AGGTAACAGCTGGAATTCAGGGG + Intergenic
961915959 3:130375402-130375424 AGGTCAAAGCTAGACCTTACCGG + Intronic
964517610 3:157529947-157529969 AGGGCATAGCTGGAAGGTACAGG + Intronic
965003804 3:162990199-162990221 AGGGCAGAGATGGAAGTTGCGGG + Intergenic
967962852 3:194939612-194939634 TGGGCAGAGCTGGAATCTGCTGG + Intergenic
968909687 4:3471348-3471370 AGGTCAGAGCAGGGATTCCCAGG + Intronic
968976453 4:3824620-3824642 GGGACAGAGATGGAATTTGCAGG - Intergenic
970098993 4:12498809-12498831 ATGTCAGAGCTTGAATATAGAGG - Intergenic
970235844 4:13957310-13957332 AGGTCATCACTGTAATTTACTGG - Intergenic
970360377 4:15303393-15303415 AGGACAGAGCTGCATTTTAAAGG + Intergenic
971230495 4:24797186-24797208 AGCTAAGAGCTGCCATTTACTGG + Intronic
973222140 4:47738729-47738751 AGCTCAGACATTGAATTTACTGG + Intronic
979457268 4:120941136-120941158 AGGTCAGACCAGGAATCTAATGG + Intergenic
982078583 4:151763835-151763857 ATGTCAGAGTTGGAATGAACTGG + Intergenic
985631497 5:1016378-1016400 TGCGCAGAGCTGGAATTCACTGG + Intronic
988399499 5:30743614-30743636 TGGATAGAGCTGGATTTTACTGG - Intergenic
988946974 5:36213863-36213885 TGGTGAGAGCTCAAATTTACTGG - Intronic
992420795 5:76602503-76602525 AGGTCCCAGCTGGAAACTACAGG - Intronic
993102420 5:83557126-83557148 GGCTCAGGGCTGGAATCTACAGG - Intronic
996395490 5:123009821-123009843 AGGTCAGTGCTAGAAGTTGCTGG - Intronic
996790989 5:127292635-127292657 ATGGCAGAGCTGGAATTTATAGG + Intronic
998562927 5:143188235-143188257 AGGTCAGCTCTGGAAATGACTGG - Intronic
1000565585 5:162843010-162843032 AGGTCAAAGCCAGAATTTAAAGG + Intergenic
1002613030 5:180433738-180433760 AGACCAGAGCTGGTATTTGCTGG - Intergenic
1003055727 6:2818338-2818360 TGGTCAGAACTGGATTTTCCTGG - Intergenic
1003981473 6:11394294-11394316 TGTTCAGAGCTGGAATAAACTGG + Intergenic
1004088019 6:12471112-12471134 AGGTCAGAGATGGAATGGGCTGG - Intergenic
1004533148 6:16473423-16473445 AGGTCAGATCTGGAAATTAATGG + Intronic
1004986001 6:21083286-21083308 AGGTCAGATGTGGAATTTTGTGG + Intronic
1005939289 6:30548647-30548669 TGGGCAGAGCTGGATTTTACAGG - Intronic
1006680748 6:35795423-35795445 AGGTCAGAGCTGGGGTCTCCAGG - Intronic
1008721802 6:54363047-54363069 AAGTCTGAGCTGGGATTTATGGG + Intronic
1012351028 6:98250525-98250547 AGGCCAGATATGGAAATTACAGG - Intergenic
1012448681 6:99332119-99332141 AGGTCAGCCCTGGAATAAACTGG + Intronic
1012817658 6:104044369-104044391 AGGTAAGAGTCAGAATTTACAGG + Intergenic
1014255795 6:119159182-119159204 AGGTCATAGCTGAAAATCACTGG - Intergenic
1018005917 6:159621730-159621752 AGGTTAGAGCTAGCATTTATTGG - Intergenic
1019131651 6:169881314-169881336 AGGGGAGAGCTGGATTTTAAAGG + Intergenic
1019982374 7:4630881-4630903 CAGTCAAAGCTGGAATTTATAGG - Intergenic
1027829269 7:83156261-83156283 AGGTCAGAGCAGAAATTGCCTGG - Exonic
1029259679 7:99293404-99293426 AGGACAGAGGTGGAAGTTGCAGG - Intergenic
1031523781 7:122799149-122799171 ATGTGAGAGCTGGTATTTAAAGG - Intronic
1031633187 7:124068886-124068908 AGGTGATAGCTGAAATTTAGAGG + Intergenic
1031974943 7:128087672-128087694 AGATGAGACCTGGAATTTATGGG + Intronic
1032185969 7:129726647-129726669 AGGGAAGAGCTGGACTTTTCAGG + Intronic
1038060426 8:23906281-23906303 AGGACAGAGCAGGAAGGTACAGG - Intergenic
1039594681 8:38780850-38780872 AGATAAAAGCTGGAGTTTACAGG + Intronic
1040458318 8:47622095-47622117 AGTTCAGAGCTTGAATGTCCAGG + Intronic
1041177209 8:55209128-55209150 AGGTCAGAGCTGGAATTTACTGG - Intronic
1041675981 8:60540346-60540368 AGATGAGAGCTGGAATTATCAGG + Intronic
1041701228 8:60791266-60791288 CATTCAGGGCTGGAATTTACAGG + Intronic
1042139693 8:65665293-65665315 ATGTCAAAGCTGGAAATAACTGG - Intronic
1044857491 8:96491685-96491707 AGGACAGAGCTGGTATTTTATGG + Intergenic
1046114370 8:109767291-109767313 AGGCCTGAAATGGAATTTACAGG + Intergenic
1046587760 8:116168440-116168462 GGGGCAGAGCAGGAATTTAGGGG + Intergenic
1047399120 8:124531269-124531291 AGGGGAGAGCTGACATTTACTGG + Intronic
1048034818 8:130667510-130667532 ATGTCAGGGCTGGAATTTAGGGG - Intergenic
1048627353 8:136199891-136199913 AGGTCAGAGCTGGAAGCTCTGGG + Intergenic
1050128823 9:2388265-2388287 AGGGCAGAACTGGAACTGACAGG + Intergenic
1054970074 9:71075919-71075941 AGGACAGAGATGGAAATCACTGG + Intronic
1055145969 9:72935227-72935249 ATTTCAGAACTGGAATTTTCAGG + Intronic
1055481057 9:76709617-76709639 AGATCAGAACTGGGATTTCCAGG + Exonic
1056291772 9:85150685-85150707 AATTCAGAGCTAGAATTCACTGG - Intergenic
1056839888 9:89990200-89990222 AGGTCAGTGCTGGAACTCATAGG - Intergenic
1058699197 9:107587089-107587111 AGGTGAGAGGAGTAATTTACAGG + Intergenic
1062562199 9:137146586-137146608 AGATCAGAGCTGGGATTTGGGGG + Intronic
1203498256 Un_GL000224v1:173638-173660 AGATCAGAGCAGGAATGTTCTGG + Intergenic
1203510810 Un_KI270741v1:115888-115910 AGATCAGAGCAGGAATGTTCTGG + Intergenic
1196691523 X:118563973-118563995 GGGTGAGAAGTGGAATTTACTGG + Intronic