ID: 1041177210

View in Genome Browser
Species Human (GRCh38)
Location 8:55209138-55209160
Sequence GAATTGAGTGAGGTCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177210_1041177215 5 Left 1041177210 8:55209138-55209160 CCAGCTCTGACCTCACTCAATTC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1041177215 8:55209166-55209188 AATGAACGTGGCCCCAAAGAGGG No data
1041177210_1041177212 -7 Left 1041177210 8:55209138-55209160 CCAGCTCTGACCTCACTCAATTC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177210_1041177214 4 Left 1041177210 8:55209138-55209160 CCAGCTCTGACCTCACTCAATTC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1041177214 8:55209165-55209187 CAATGAACGTGGCCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177210 Original CRISPR GAATTGAGTGAGGTCAGAGC TGG (reversed) Intronic
901127637 1:6940751-6940773 GAGTTGAGGGAGGCCAGAGAAGG + Intronic
901750583 1:11404940-11404962 GTACTTAGGGAGGTCAGAGCAGG - Intergenic
902708501 1:18222774-18222796 GAATTTTGTGAGATCAGGGCTGG + Intronic
903189188 1:21647062-21647084 GAATTGAGTGTGTTCAGGGAGGG - Intronic
903579152 1:24358054-24358076 TAAGTGAGTGAGGTCAGAAAGGG + Exonic
903663774 1:24994736-24994758 CATGTGAGTGAGCTCAGAGCTGG - Intergenic
903816576 1:26068245-26068267 GAATTGATTTAGGTCAGTGAGGG - Intronic
904577113 1:31511959-31511981 AAGGTGAGTTAGGTCAGAGCAGG + Intergenic
905224434 1:36469816-36469838 GCATGGAGTCTGGTCAGAGCTGG + Exonic
905877124 1:41439263-41439285 GCTTTGAATGGGGTCAGAGCTGG + Intergenic
907095440 1:51775435-51775457 GAACAGAATGAGGGCAGAGCTGG - Intronic
907570067 1:55475267-55475289 GAATTGAGTGATGCCAGTGGAGG + Intergenic
907855751 1:58301954-58301976 GAATTAAGTGAGATCATAGAAGG - Intronic
910034372 1:82773164-82773186 GAATTGATTGAGGTTATCGCAGG + Intergenic
910447953 1:87318025-87318047 GAATTTTGTGAGGTGAGAGATGG + Intergenic
914828203 1:151151056-151151078 GCATTTAGAGAGGTCAGAGAAGG - Intergenic
915218033 1:154352874-154352896 GAATTGTGAGAGTTCAGAGGTGG - Intergenic
916033069 1:160895274-160895296 GAATTGAGTCAGGACAGTACTGG + Intergenic
916831717 1:168499147-168499169 GAAGTGAGTGATATCACAGCAGG - Intergenic
924620362 1:245654798-245654820 GAATAGGTTCAGGTCAGAGCAGG + Intronic
1063074193 10:2698582-2698604 GACTTGAGTGAGCTCAGCACTGG + Intergenic
1064643797 10:17440021-17440043 TAATGGAGTGAAGCCAGAGCTGG - Intronic
1067082884 10:43221562-43221584 GAATGGTGTGAGGTGACAGCAGG + Intronic
1067252312 10:44597311-44597333 GAAATAACTAAGGTCAGAGCAGG + Intergenic
1067743309 10:48913422-48913444 GAATTGGGTGAGATCAGATTGGG + Exonic
1068112096 10:52691782-52691804 AAAGTGACTTAGGTCAGAGCAGG + Intergenic
1068439534 10:57033044-57033066 GATTTGAGAGAGGCCAGAGGTGG + Intergenic
1068739374 10:60451412-60451434 GAATTTGGTGAGGCCAGAGCTGG + Intronic
1070341819 10:75504918-75504940 GGATTGGGGGAGGTCAGAGTAGG + Intronic
1071255719 10:83870036-83870058 GAAATGAGAGAGGTCAAAGCAGG - Intergenic
1071332066 10:84570687-84570709 TCAGTGATTGAGGTCAGAGCTGG + Intergenic
1071549058 10:86552224-86552246 GAATTCAGAGAGGGCACAGCAGG - Intergenic
1072158623 10:92746274-92746296 AAATAGATTCAGGTCAGAGCAGG + Intergenic
1075003709 10:118815907-118815929 GAATTGAATGAGTTCATGGCCGG + Intergenic
1075838584 10:125477553-125477575 CTAATGAGTGAGGACAGAGCTGG - Intergenic
1077001605 11:326163-326185 GAATTGTGTGAGGTCTGAGGAGG + Intronic
1079036766 11:17026735-17026757 AAACTGAGAGAGGGCAGAGCTGG + Intergenic
1079098675 11:17527203-17527225 GACGTGAGTGAGGCCAGAGCAGG - Exonic
1080553534 11:33395042-33395064 GAATTGGGTCAGGTAACAGCTGG - Intergenic
1083666062 11:64275402-64275424 GAATGGGCTAAGGTCAGAGCAGG - Intronic
1084164575 11:67369473-67369495 GAACTGAGTCAGGCAAGAGCTGG - Intronic
1084277482 11:68061612-68061634 GAAGGGACTGAGGTCAGAGCTGG + Intronic
1084654655 11:70508135-70508157 TCATTGCCTGAGGTCAGAGCCGG - Intronic
1085415949 11:76319005-76319027 GGATTTATTTAGGTCAGAGCCGG - Intergenic
1086167783 11:83799391-83799413 GAATTAAGTGAGGACAGGGTAGG + Intronic
1088624826 11:111722464-111722486 GAAGTAGGTGAGGTCAGAGATGG + Intronic
1089389004 11:118087231-118087253 GAAGTCAGTAAGGGCAGAGCTGG - Intronic
1089694511 11:120208898-120208920 GAAATGGCTGAGGGCAGAGCTGG + Intergenic
1090517740 11:127446878-127446900 GAATTGAGTACAGTCAGAGAAGG + Intergenic
1091671418 12:2454718-2454740 GAATGGAGTGCGGACAAAGCAGG - Intronic
1092077179 12:5683777-5683799 GAACTCAGTGAGGACAGGGCAGG + Intronic
1092457184 12:8654421-8654443 GACTTGGGTGAGTTCAGATCTGG - Exonic
1094086671 12:26600750-26600772 AAATAGAGTGAGAGCAGAGCAGG - Intronic
1094175229 12:27534319-27534341 GAATTGAGTAAGTTCACTGCAGG + Intronic
1094583775 12:31758397-31758419 GAAATGAGTCAGGTTGGAGCAGG - Intergenic
1094583778 12:31758425-31758447 GAAATGAGTCAGGTTGGAGCAGG - Intergenic
1100085783 12:90908745-90908767 GAAGTGAGTGTGGTCAGAGATGG + Intronic
1101323962 12:103698319-103698341 GAATTTAGTGAGATCAGAAAGGG - Intronic
1102017764 12:109659316-109659338 GAATTCAGTCAGGGCACAGCAGG + Intergenic
1104538170 12:129638003-129638025 GATTTGGGTGAGGACAGAGCAGG + Intronic
1104732526 12:131115771-131115793 GAAAGGGGTGAGGTCTGAGCTGG + Intronic
1105543962 13:21338594-21338616 GTATTCAGAGTGGTCAGAGCAGG + Intergenic
1107278132 13:38700839-38700861 GATGTGAGTGAAGTCAGAGTAGG + Intronic
1107290530 13:38847945-38847967 GGATGGAGTGTGGGCAGAGCTGG + Intronic
1112464386 13:99630712-99630734 GATTTAAGAGAGGGCAGAGCTGG - Intronic
1112493044 13:99884270-99884292 GAAAAGGGTGAGCTCAGAGCTGG + Intronic
1113138102 13:107116419-107116441 GATTTGACTGAGGTCAGACAGGG - Intergenic
1113596878 13:111539875-111539897 GGATTGAGTGAAGTCAGGCCTGG + Intergenic
1114912604 14:27219672-27219694 AAGGTGAGTTAGGTCAGAGCAGG - Intergenic
1118029616 14:61807618-61807640 GAAATGAGTGAAGCCACAGCAGG - Intergenic
1120424432 14:84329271-84329293 GGAAAGAGTGAGGTAAGAGCAGG + Intergenic
1123988453 15:25665563-25665585 GGATTGGGTGGGGTCAGAGATGG + Intergenic
1125130830 15:36281892-36281914 GAATTCAGTGAGAATAGAGCAGG + Intergenic
1125670388 15:41467916-41467938 GCACTTTGTGAGGTCAGAGCAGG + Intronic
1126356880 15:47805426-47805448 GACTTGAGGAGGGTCAGAGCGGG + Intergenic
1128878085 15:71218345-71218367 GATTTGGGTGAGGTCTGAGTGGG + Intronic
1128927722 15:71674079-71674101 GAATAGAATGAGGTCAGCACAGG - Intronic
1131062030 15:89410297-89410319 GAATTGAATCAGGGCAGAGCAGG + Intergenic
1131149447 15:90037620-90037642 GGATGGAGTGAGGGCTGAGCTGG + Intronic
1133860945 16:9594728-9594750 GAATTGGGTATGCTCAGAGCAGG - Intergenic
1134442382 16:14307013-14307035 GAATCGTGTGAGATCAGTGCTGG + Intergenic
1135075581 16:19390611-19390633 GCATTGAATGAGGTAAGACCTGG - Intergenic
1135731554 16:24899062-24899084 GAATTTAGGGAGGTCAAGGCAGG - Intronic
1137395898 16:48115953-48115975 GAATTGTGTGAGCAGAGAGCTGG + Intronic
1138511232 16:57509632-57509654 TAAATGAGTGAGGGCAGTGCAGG + Intergenic
1138675955 16:58651252-58651274 GAATTAAGTGAGCTCAGTGTTGG - Intergenic
1140934613 16:79658775-79658797 TCATTCAGCGAGGTCAGAGCTGG + Intergenic
1141431844 16:83974260-83974282 GACTTGCCTGAGGCCAGAGCCGG - Intronic
1141921791 16:87140385-87140407 GGATTGAATGAGGTCACAGGGGG + Intronic
1143178617 17:4970582-4970604 GAATGGACTGAGGTTACAGCTGG - Intronic
1143264822 17:5628518-5628540 TTATGGAGTGAAGTCAGAGCTGG + Intergenic
1144246484 17:13371072-13371094 GAAATGAATGAAATCAGAGCTGG - Intergenic
1146124421 17:30220629-30220651 GACCTGTGTGAGGTCAGAGAAGG - Intronic
1147954418 17:44124148-44124170 GCAGTGTGTGCGGTCAGAGCTGG - Intergenic
1148166448 17:45487241-45487263 GAATTAAATGAGGTTAGAGAGGG - Intronic
1148714967 17:49709294-49709316 GAATTGTTTGAGGTCCCAGCTGG - Intergenic
1148761108 17:50001079-50001101 GAATTGGGTGTGGGGAGAGCTGG + Intergenic
1148767038 17:50045518-50045540 GTTTTGAGTGGGGTCAGATCAGG - Intergenic
1148774623 17:50088454-50088476 GGACAGAATGAGGTCAGAGCAGG - Intronic
1150397618 17:64833641-64833663 GAATTAAATGAGGTTAGAGAGGG - Intergenic
1151519171 17:74616136-74616158 GAAGGAAGTGAGGTCAGAACGGG + Intronic
1151596658 17:75082147-75082169 GAATGGAGTGGGGTAAGAGTGGG - Intergenic
1152811633 17:82385369-82385391 GGGGTGAGTGAGGTCACAGCAGG + Intergenic
1152839487 17:82557897-82557919 GCATTGAGGGAGGCCAAAGCAGG - Intronic
1153388026 18:4521681-4521703 GAAGTGAATGAGGTCAAAGATGG + Intergenic
1153640726 18:7154791-7154813 GAATTGAGAGAGGAGAGGGCAGG + Intergenic
1154986032 18:21551835-21551857 GAATTGGGTCAGGTCAGAGTTGG - Intronic
1156267501 18:35501738-35501760 GAATTTAGTGAGACCAGAGGAGG - Intergenic
1156804858 18:41165774-41165796 GAACTGAGTGAGGTTAGGGCAGG + Intergenic
1157387390 18:47269613-47269635 TACTTGAGTGAGGACAGAGGAGG - Intergenic
1160223727 18:76996676-76996698 ATATTGGGGGAGGTCAGAGCTGG + Intronic
1163927494 19:20360093-20360115 AAAATGAGTCAGGGCAGAGCAGG - Intergenic
1164751853 19:30662114-30662136 GAATTAAGAGAGGACAGGGCAGG - Intronic
1164896786 19:31883745-31883767 GGATTGTGTGCGGTCAGGGCGGG + Intergenic
1166549663 19:43656826-43656848 GAGTTGAAGGAGGTCTGAGCTGG - Intronic
1167106666 19:47434142-47434164 GACATGGCTGAGGTCAGAGCAGG + Intronic
1168115154 19:54218202-54218224 GAAGAGAGTGAGGTCACAGCAGG + Intronic
1168120851 19:54251894-54251916 GAAGAGAGTGAGGTCGCAGCAGG + Intronic
1168124430 19:54275791-54275813 GGAGAGAGTGAGGTCACAGCAGG + Intronic
1168308137 19:55447169-55447191 GAAAGGAGGCAGGTCAGAGCAGG - Intergenic
926244245 2:11111113-11111135 GAATTGATTGAGGTGGGAGGTGG + Intergenic
928840763 2:35601763-35601785 GAAATCAGAGAGGACAGAGCAGG - Intergenic
929036386 2:37696371-37696393 GAATTAACTGAAGTCAGAGATGG - Intronic
930696490 2:54416913-54416935 GAATAGAAAGAGGTCACAGCAGG + Intergenic
933279075 2:80312397-80312419 AAAGTGACTTAGGTCAGAGCAGG + Intronic
933827171 2:86172707-86172729 GAATTGAGTAAGGGGAGAACAGG - Intronic
933968461 2:87450595-87450617 GAATTGAGTGAGGAGAGAAAGGG - Intergenic
936325331 2:111499909-111499931 GAATTGAGTGAGGAGAGAAAGGG + Intergenic
936977492 2:118234210-118234232 GAACTGAATGAGGTAAGAGTGGG - Intergenic
938060492 2:128250831-128250853 GAAGTGAGGGAGGACAAAGCAGG + Intronic
944469300 2:200035915-200035937 GACATGAGTGTGGTGAGAGCAGG + Intergenic
945034579 2:205693630-205693652 AAATTGAGTGAGTTAAGAGTTGG + Intronic
945633671 2:212319026-212319048 GACTTCAGTGATGTCATAGCTGG - Intronic
946328548 2:218997276-218997298 GAACTGAATGAGGTCAGGGTGGG - Intergenic
946677544 2:222177884-222177906 GAAGTCAGTGAGGTTAGAGCTGG + Intergenic
1169131711 20:3169210-3169232 GACTAGAGTGAGGCCAGAGAGGG - Intronic
1171136413 20:22698713-22698735 GAATTGAGTCAGAGCAGAGAGGG - Intergenic
1173295198 20:41749457-41749479 GAATAGAGCTGGGTCAGAGCAGG - Intergenic
1173873844 20:46357590-46357612 GACCTCAGTGAGGGCAGAGCAGG - Intronic
1175196831 20:57249873-57249895 GGATTGAGTGAGATCATGGCAGG - Intronic
1175281189 20:57805077-57805099 CAGTTGGGTGAGGACAGAGCGGG - Intergenic
1177460061 21:21397589-21397611 GAATGGAGAGAGGTCAGGGATGG + Intronic
1178470150 21:32885287-32885309 TAATTCAGTGAGATCAGACCTGG - Intergenic
1178547944 21:33509160-33509182 GGATTGCTTGAGGCCAGAGCTGG + Intronic
1178700416 21:34828550-34828572 GAATTTGGGGAGGTCAGAGGTGG + Intronic
1179904411 21:44414861-44414883 GAACTGGCTGAGGTCACAGCTGG - Intronic
1180623611 22:17179150-17179172 GAGTTGGGTGAGGACAGAGGTGG + Exonic
1181630673 22:24149625-24149647 GAATTAAGTTAGGTCAGAGCAGG + Intronic
1182624473 22:31635761-31635783 CAATTCTCTGAGGTCAGAGCTGG + Intronic
1184420384 22:44378751-44378773 GGATTGAGACAGGACAGAGCAGG - Intergenic
1185148376 22:49151243-49151265 GAATGGAGTCAGGTCTGAGGAGG - Intergenic
949163792 3:912957-912979 AAACTGACTCAGGTCAGAGCAGG - Intergenic
950538987 3:13598824-13598846 GACATGAGTGAAGTCAGAGGAGG + Intronic
950594062 3:13963314-13963336 AAAGTGACTCAGGTCAGAGCAGG + Intronic
950845902 3:16015792-16015814 AGAATGAGTTAGGTCAGAGCAGG + Intergenic
952004486 3:28826838-28826860 GAATTGAGCAAGGACAGTGCTGG + Intergenic
952460792 3:33523814-33523836 GAAAAGGGTGGGGTCAGAGCTGG + Intronic
954818977 3:53308501-53308523 GAATTGATTGAGGACAGGCCTGG - Intronic
958863899 3:99478406-99478428 GAATTGATATAGGTTAGAGCTGG + Intergenic
959550173 3:107645969-107645991 GAATTATGTGCTGTCAGAGCTGG + Intronic
959894002 3:111586851-111586873 GATTTGGGAGAGGTCAGAGGTGG - Intronic
960637338 3:119796477-119796499 GGCTTGAGTGAGCTCAGGGCTGG - Intronic
963377278 3:144484303-144484325 GAATCCAGAGAGGTGAGAGCTGG - Intergenic
965203524 3:165692142-165692164 GATTTGAGTGAGGTCATGGGTGG - Intergenic
968635478 4:1676258-1676280 GACTGGAGTGATGCCAGAGCCGG - Intronic
970082331 4:12301707-12301729 GAACTGAATGAGGTAACAGCTGG - Intergenic
972095469 4:35342450-35342472 GTTTTGAGTGTGTTCAGAGCAGG + Intergenic
972316584 4:37932570-37932592 GAATTGTGTCATTTCAGAGCAGG + Intronic
977361808 4:96015049-96015071 GAAATGAGAGAAGTCAGTGCGGG - Intergenic
979632430 4:122919108-122919130 GTGTTCAGTGAGGTCAGGGCTGG - Intronic
985242201 4:187942521-187942543 GAAGTGAATGAGGTCAGATGTGG - Intergenic
985389263 4:189478277-189478299 GAAATGGGTGAGGCAAGAGCAGG - Intergenic
985472758 5:55704-55726 GAGGTGAGTGAGGTCAGAGGGGG + Intergenic
985542098 5:492080-492102 GAAGGGAGGGAGGTCAGGGCCGG + Intronic
986416165 5:7530339-7530361 GAATTGAGTAAGGCAAGAGTTGG + Intronic
987418586 5:17691568-17691590 GAGATGAGAAAGGTCAGAGCAGG - Intergenic
987555962 5:19449414-19449436 AAATTGAGTGAAGTCAGAGTAGG + Intergenic
988383820 5:30535908-30535930 GAAATGATAGAGGTCAGATCTGG + Intergenic
989388634 5:40877813-40877835 GGAATGAGTCAGGGCAGAGCAGG + Intergenic
989570741 5:42944003-42944025 GAATTTACTGAGCTCAGGGCTGG - Intergenic
989601795 5:43206984-43207006 GAATTGAGTCAGGACAGTACTGG + Intronic
990808738 5:59697792-59697814 GAGTTGATTCAGGTCAGGGCAGG + Intronic
991306413 5:65180615-65180637 GATTTGAGTGAGGCAAGAGGAGG - Intronic
991454067 5:66783705-66783727 AAATTGAGTGATTTCAGAGAAGG + Intronic
992035894 5:72775695-72775717 GAATTGAGAGAAGTCACAACTGG + Intergenic
992734894 5:79709042-79709064 GAAGAAAGTGAGGTAAGAGCCGG + Intronic
993459264 5:88163169-88163191 AAATTGAGTGAGGTTATAGTGGG - Intergenic
994660690 5:102650387-102650409 GAATTAGGTGAGGTCAGGGAAGG + Intergenic
995515375 5:112949810-112949832 GAAGTGAGTGAAATCCGAGCTGG + Intergenic
998527020 5:142851883-142851905 GACTTGCCTGAGGTCATAGCAGG + Intronic
998729790 5:145061841-145061863 GAACTGAGTGAGGGCAGGGAAGG - Intergenic
998818255 5:146034882-146034904 GAATCACTTGAGGTCAGAGCTGG + Intronic
999050750 5:148521799-148521821 GAAATGAGACAGTTCAGAGCTGG + Intronic
999301394 5:150492835-150492857 GAAATGAGTGTTGTCATAGCAGG + Intronic
1000044732 5:157512882-157512904 GAATTGAGGTAGGTCAGGGTGGG - Intronic
1000113786 5:158134555-158134577 GAATTGAGAGAGGAAAGAGAAGG + Intergenic
1000454602 5:161434452-161434474 GAAATGAGAGAGGTTAGAGAGGG - Intronic
1001786726 5:174419976-174419998 AACTTGAGTGAAATCAGAGCAGG - Intergenic
1004059110 6:12173877-12173899 TAATTGACTGATCTCAGAGCTGG - Intergenic
1005332413 6:24762464-24762486 GAATTTTGGGAGGTCAGGGCGGG - Intergenic
1007250441 6:40491437-40491459 AAATGGAGTGGGGCCAGAGCCGG - Intronic
1007616701 6:43184083-43184105 GAATGGAGTGAAGACAGAGAGGG - Intronic
1007659931 6:43477747-43477769 GAATGGAGTAAGGTCCGAGGCGG + Intronic
1007696110 6:43735159-43735181 GAATTGAGAGAGGGAAGAGAAGG - Intergenic
1008013986 6:46497292-46497314 AAACTGAATGAGGTGAGAGCCGG + Intergenic
1009969224 6:70609018-70609040 GAATTGAGTCAGGACAGTACTGG - Intergenic
1011662306 6:89604988-89605010 GAATTGAGTGGGGTGGGGGCGGG - Intronic
1012435497 6:99210968-99210990 GAACTGAGGGAGTTCAGGGCAGG - Intergenic
1019420399 7:948095-948117 GAATAGAGTGGGTTCAGGGCAGG - Intronic
1019915172 7:4128510-4128532 GCATTGAGTGAGGTCTTAGCAGG + Intronic
1020632557 7:10656991-10657013 GAGGTGAGTGGGGTCAGATCTGG + Intergenic
1021273177 7:18617329-18617351 GAGTTGAGAGAGGTCAGAGAGGG - Intronic
1022340742 7:29465244-29465266 GAATTGTGGCAGGTCAGAGAGGG + Intronic
1026140454 7:67701252-67701274 GAATTGTGTAAGTTCAAAGCTGG - Intergenic
1028088790 7:86671759-86671781 AAATGAAGTGAGGTCAAAGCAGG - Intronic
1030264049 7:107598228-107598250 GAATTCAGTGAAGTAATAGCTGG + Intronic
1030640264 7:111996964-111996986 GAGTTGAGGGAGGTCAGGGTTGG + Intronic
1033319959 7:140330472-140330494 GAGTGGAGTGTGGGCAGAGCAGG - Intronic
1033499077 7:141929524-141929546 GAATGGAGAGAGGTCTGGGCAGG - Exonic
1033960052 7:146903596-146903618 GGATAGAGAGAGGTCAGATCTGG - Intronic
1034576676 7:152005918-152005940 GTTTTGAGAGAGGTCAGGGCTGG + Intronic
1035245656 7:157560718-157560740 GAATTGGGTGAGGTGGGAGGAGG - Intronic
1036132323 8:6127204-6127226 GAATTCATTGAGGCCAGAGTTGG + Intergenic
1037593277 8:20331390-20331412 GAATTGAGTGAGGCTAAGGCAGG + Intergenic
1037693261 8:21201794-21201816 GCATTGGGTCAGGTCAGGGCTGG + Intergenic
1038683543 8:29693878-29693900 GCATTGAGTGAGGTATGAGAGGG + Intergenic
1041175600 8:55193441-55193463 GGATAGAGAGAGGTCAGGGCAGG - Intronic
1041177210 8:55209138-55209160 GAATTGAGTGAGGTCAGAGCTGG - Intronic
1041181660 8:55255798-55255820 AAATTGCCTGTGGTCAGAGCTGG + Intronic
1041198484 8:55425682-55425704 GAATGCAGTGAGCTCAGAGGGGG - Intronic
1041894273 8:62905850-62905872 GAAGTGAGTGAAGTCAGAGAAGG - Intronic
1042400004 8:68333677-68333699 GAATTGATTTGGGTCAGAGGAGG + Intronic
1043431501 8:80199523-80199545 GAATTGCTTGAGCTCAGAGGCGG - Intronic
1043598396 8:81911540-81911562 GAGGTGACTTAGGTCAGAGCAGG + Intergenic
1043729299 8:83654096-83654118 TAATTGAGTGTGGCCAGAACTGG + Intergenic
1043917321 8:85937997-85938019 GAATTCAGTGAGGTCAATGATGG + Intergenic
1047313537 8:123711948-123711970 GAATTGAGTCTGATGAGAGCCGG - Intronic
1048269466 8:133017074-133017096 GCATGGGGTGTGGTCAGAGCTGG + Intronic
1048913323 8:139157729-139157751 GAGATGAATGAGGTCAGAGCAGG + Intergenic
1048931146 8:139316271-139316293 GCCTGGAGTGGGGTCAGAGCAGG + Intergenic
1049519224 8:143079792-143079814 GAAGTGTGGGAGGACAGAGCTGG + Intergenic
1051957575 9:22714074-22714096 GAATTGAGTGGGGGGAGGGCGGG + Intergenic
1052772163 9:32699672-32699694 CACTTTAGTGAGGTCAGAGGTGG + Intergenic
1057168908 9:92949137-92949159 GATCTGGGGGAGGTCAGAGCAGG + Intronic
1058738514 9:107919322-107919344 GGAGTGAGAGATGTCAGAGCTGG + Intergenic
1060399522 9:123340167-123340189 GAAGTGTGTGAGGATAGAGCAGG - Intergenic
1061086239 9:128400449-128400471 GAAGTGAGTGAAGGCAGGGCAGG + Intergenic
1061623332 9:131825437-131825459 CATTTGAGTGAGGTGGGAGCAGG + Intergenic
1061999444 9:134208478-134208500 GAGATCAGAGAGGTCAGAGCTGG - Intergenic
1062104945 9:134750296-134750318 GAAGGGAGGGAGGTCTGAGCTGG - Intronic
1186534248 X:10330323-10330345 GAAGTGAGTCAGGGCCGAGCAGG - Intergenic
1186868628 X:13747365-13747387 GAATTGAGAGAGGTCAAACCAGG + Intronic
1187702083 X:21972537-21972559 GAATTGAGTCAGGACAGTACTGG + Exonic
1189375735 X:40465167-40465189 GATTTGAGTGAGGTCCAAGGTGG + Intergenic
1193337949 X:80312945-80312967 CCATTGTGTGAGGTCAGAGGTGG - Intergenic
1193686333 X:84580878-84580900 GAGTTGAGAGAGGCCAGAGGTGG + Intergenic
1194507179 X:94746651-94746673 GATTTGAGAGGGGTCAGGGCTGG + Intergenic
1201451946 Y:14126061-14126083 GAATTTAGAGAAGTCAGAGCAGG + Intergenic
1201900356 Y:19041944-19041966 AAAATGAGTCAGGGCAGAGCAGG + Intergenic