ID: 1041177212

View in Genome Browser
Species Human (GRCh38)
Location 8:55209154-55209176
Sequence TCAATTCCACACAATGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041177209_1041177212 3 Left 1041177209 8:55209128-55209150 CCAGTAAATTCCAGCTCTGACCT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177208_1041177212 8 Left 1041177208 8:55209123-55209145 CCAAGCCAGTAAATTCCAGCTCT 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177206_1041177212 13 Left 1041177206 8:55209118-55209140 CCATCCCAAGCCAGTAAATTCCA 0: 1
1: 0
2: 2
3: 45
4: 561
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177207_1041177212 9 Left 1041177207 8:55209122-55209144 CCCAAGCCAGTAAATTCCAGCTC 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data
1041177210_1041177212 -7 Left 1041177210 8:55209138-55209160 CCAGCTCTGACCTCACTCAATTC 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1041177212 8:55209154-55209176 TCAATTCCACACAATGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041177212 Original CRISPR TCAATTCCACACAATGAACG TGG Intronic
No off target data available for this crispr