ID: 1041180477

View in Genome Browser
Species Human (GRCh38)
Location 8:55242465-55242487
Sequence GGTAACAAGGCACTGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041180473_1041180477 1 Left 1041180473 8:55242441-55242463 CCTGTGACAAAGGAAATGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1041180477 8:55242465-55242487 GGTAACAAGGCACTGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041180477 Original CRISPR GGTAACAAGGCACTGCAAGA AGG Intronic
No off target data available for this crispr