ID: 1041183263

View in Genome Browser
Species Human (GRCh38)
Location 8:55270990-55271012
Sequence GAGCTAGGGAGGCTGAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041183256_1041183263 -6 Left 1041183256 8:55270973-55270995 CCTCTGACCATACCTAAGAGCTA 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1041183263 8:55270990-55271012 GAGCTAGGGAGGCTGAGCATGGG No data
1041183255_1041183263 6 Left 1041183255 8:55270961-55270983 CCAGAACATCAACCTCTGACCAT 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1041183263 8:55270990-55271012 GAGCTAGGGAGGCTGAGCATGGG No data
1041183254_1041183263 13 Left 1041183254 8:55270954-55270976 CCATTGGCCAGAACATCAACCTC 0: 1
1: 0
2: 2
3: 17
4: 149
Right 1041183263 8:55270990-55271012 GAGCTAGGGAGGCTGAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041183263 Original CRISPR GAGCTAGGGAGGCTGAGCAT GGG Intronic
No off target data available for this crispr