ID: 1041185191

View in Genome Browser
Species Human (GRCh38)
Location 8:55292265-55292287
Sequence CCAGGTCTAAATGGTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 10, 3: 57, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041185191_1041185195 -10 Left 1041185191 8:55292265-55292287 CCAATAAAACCATTTAGACCTGG 0: 1
1: 0
2: 10
3: 57
4: 326
Right 1041185195 8:55292278-55292300 TTAGACCTGGAGATTTTTGCGGG No data
1041185191_1041185196 -9 Left 1041185191 8:55292265-55292287 CCAATAAAACCATTTAGACCTGG 0: 1
1: 0
2: 10
3: 57
4: 326
Right 1041185196 8:55292279-55292301 TAGACCTGGAGATTTTTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041185191 Original CRISPR CCAGGTCTAAATGGTTTTAT TGG (reversed) Intronic
902647709 1:17813727-17813749 CTAGGTCTAAACGGTTTCACTGG - Intronic
902867960 1:19293075-19293097 CCAGGTCTACATGGCTTCATTGG + Intergenic
903151220 1:21410731-21410753 CCAGGACTACATGGTGTTACTGG - Intergenic
906959400 1:50407650-50407672 CCAGACCTAGATGGTTTTATTGG + Intergenic
908947112 1:69511743-69511765 CCAGGCCTAGATGGCTTTACTGG + Intergenic
908950999 1:69562572-69562594 CCATCTCTAGGTGGTTTTATAGG - Intergenic
909246287 1:73288920-73288942 CCAGGCCTAGATGGCTTTTTTGG - Intergenic
909930718 1:81496286-81496308 CCATGCATAAAAGGTTTTATTGG - Intronic
910548118 1:88442256-88442278 CCAGGTCCAAATGGTTTCACTGG + Intergenic
910646736 1:89523165-89523187 GCAGGTCTCAATCGTTTTAGAGG - Intergenic
910699291 1:90055474-90055496 CCAGGCCTAGGTGGTTTTATAGG + Intergenic
911174644 1:94806800-94806822 CAAGGTCTGAATGGTCTGATTGG - Intergenic
911244206 1:95498858-95498880 GCAGGTCCAAGTGGTTTGATGGG - Intergenic
913015416 1:114729095-114729117 CAAGGTCTAAATTTTTTTTTTGG + Intronic
913092494 1:115487784-115487806 CCAGGTCCAGATGGATTCATTGG + Intergenic
913599851 1:120412656-120412678 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914087210 1:144464019-144464041 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914192986 1:145426991-145427013 CCAGGTCCAGATGGTTTCACTGG + Intergenic
914311399 1:146470189-146470211 CCAGGTCCAGATGGTTTCACTGG - Intergenic
914591018 1:149105905-149105927 CCAGGTCCAGATGGTTTCACTGG + Intergenic
915617752 1:157053536-157053558 CCAGATCCAAATGGTTTCACTGG - Intergenic
916139937 1:161687528-161687550 CCAGTCCTAGATGGTTTTACTGG - Intergenic
916940688 1:169674073-169674095 TCAGTTCTGAATGGTTTTGTAGG + Intronic
918960941 1:191276739-191276761 ACAGGCCTATATGGTTTTACTGG + Intergenic
919028843 1:192212920-192212942 CCAGGCCTAGATATTTTTATCGG + Intergenic
919562704 1:199141698-199141720 CCAGGCCTAGATGGTTTAACTGG + Intergenic
921901393 1:220455317-220455339 CAGTGTCTAAATGGTTTTTTTGG + Intergenic
922294598 1:224238589-224238611 CCAGGTCAAAATGGATTGAATGG - Intronic
1063056916 10:2515153-2515175 CCAGGCCCAGATGGTTTTACTGG + Intergenic
1065163744 10:22952557-22952579 CCAGGTCCAGATGGTTTTACTGG + Intronic
1065311085 10:24416526-24416548 CCATGTCTAAATATTTTTAAAGG + Intronic
1065365474 10:24931748-24931770 CCATGTCAAGATGGTTTTACTGG + Intronic
1066522087 10:36232399-36232421 CCAGGACCAGATGGCTTTATGGG + Intergenic
1066569031 10:36751632-36751654 CCAGGCCCAAATGGGTTTAGTGG + Intergenic
1066652323 10:37668426-37668448 CCAGGCCAAAATGGTTTTGAAGG - Intergenic
1066684732 10:37969816-37969838 TCAGGCCTAAATGGTTTCATTGG + Intronic
1067036092 10:42918605-42918627 CCAGGCCAAAATGGTTTTGAAGG - Intergenic
1067244725 10:44529694-44529716 CCAGGATGAAATGGCTTTATTGG - Intergenic
1067304121 10:45043903-45043925 CTAGGTCCAGATGGTTTTAATGG - Intergenic
1067840442 10:49672494-49672516 CCAGGCCAACTTGGTTTTATTGG - Intergenic
1068968864 10:62941723-62941745 CTCTGTCTTAATGGTTTTATTGG + Intergenic
1069644845 10:69986961-69986983 CCAGGCTCAAATGGTTTTACAGG + Intergenic
1071199086 10:83196790-83196812 CCAGGCCCAAATGGTTTCACTGG - Intergenic
1071845084 10:89513773-89513795 CCTGGTTTAAATGGTTTCTTTGG - Intronic
1072194266 10:93102170-93102192 CCAGGCCCAAATGGCTTCATAGG - Intergenic
1072236325 10:93457137-93457159 CCAGGTCTACATGGAGTTAAGGG + Intronic
1073026563 10:100491292-100491314 CCAGGCCTAGATGGTTTCACTGG + Intronic
1073039348 10:100590949-100590971 TCAGGCCTATATGGTTTTACTGG + Intergenic
1073576141 10:104626533-104626555 CCAGGCCCAAATGGTTTCACTGG + Intergenic
1073969685 10:109033141-109033163 CTAAGTCTACATGGTTTAATTGG - Intergenic
1074747367 10:116548294-116548316 CCATGTACAAATGGTTCTATTGG + Intronic
1074879387 10:117642149-117642171 CCAGGACCAAATGGTTTCATTGG - Intergenic
1075869106 10:125755602-125755624 CCAGGTTAAGATGGTTTTACTGG - Intronic
1078020453 11:7652363-7652385 GCAGGTCTAAAGGGCTTTGTGGG - Intronic
1078472077 11:11597397-11597419 CCAGGTCCAAATGGCTTTACTGG - Intronic
1080926584 11:36763531-36763553 CCAGCTTTGAATGGTTTTTTTGG + Intergenic
1081844081 11:46225923-46225945 TCAGGTCCAGATGGTTTCATGGG + Intergenic
1082985262 11:59163565-59163587 CCAGGGCTAGATGCTTTTACTGG + Intergenic
1085207079 11:74741638-74741660 CCAATTCTAAGTGGATTTATAGG + Intergenic
1085209883 11:74766794-74766816 CCAGGCACAGATGGTTTTATGGG + Intronic
1086267218 11:85014995-85015017 ACAGGTATAAATAGTTCTATAGG - Intronic
1086575550 11:88335967-88335989 TCAGCACTAATTGGTTTTATAGG - Intronic
1086750370 11:90486374-90486396 CCAGCTCAAGATGGCTTTATAGG + Intergenic
1087954751 11:104271789-104271811 TCAGGTCTTAATGGCTTTACTGG - Intergenic
1088435415 11:109806517-109806539 GCAGGTCCAGATGGTTTTAGTGG + Intergenic
1089122794 11:116150358-116150380 TCAGGCCTAAATGGTTTCACTGG + Intergenic
1089437061 11:118478014-118478036 ACAGGTTTAATTGGTTTGATGGG - Exonic
1091830524 12:3546702-3546724 CCAGGCATATATGGTTTTACTGG + Intronic
1092734812 12:11570957-11570979 CCAGGCCTAGATGGCTTTACTGG - Intergenic
1093186556 12:16026695-16026717 CCAGCTCTAGATGGCTTCATTGG + Intronic
1093316507 12:17657757-17657779 GCATGTCTCAATGCTTTTATTGG + Intergenic
1093695336 12:22152901-22152923 CCAGGTCCAAATGGCTTCAGTGG + Intronic
1093826459 12:23696234-23696256 CCAGGCCCAGATGGTTTCATTGG - Intronic
1094584109 12:31761305-31761327 CCAGGTCTAGATATTTTCATAGG + Intergenic
1098546720 12:71719578-71719600 CCAGGCTTAGATGGTTTCATTGG - Intergenic
1098751935 12:74304244-74304266 GCCTGGCTAAATGGTTTTATTGG + Intergenic
1099218584 12:79883618-79883640 CCAGATCTATATGGTTAGATAGG - Intronic
1099648154 12:85387409-85387431 CCAGGAACAAATGGTTTCATAGG + Intergenic
1099742062 12:86650915-86650937 TCAGGACTAGATGTTTTTATAGG + Intronic
1099761987 12:86935019-86935041 CCAGGTCTTAATGGATTCACTGG + Intergenic
1104374800 12:128255372-128255394 CCAGGCCCAGATGGTTTTATTGG - Intergenic
1106321804 13:28646374-28646396 CCAGGTCCAAGTAGTTTTATAGG + Intergenic
1107261055 13:38491902-38491924 CCAGGCCCAGGTGGTTTTATTGG - Intergenic
1108489116 13:50962314-50962336 CCAGGTCCAAATGGCTTCACTGG - Intronic
1109502517 13:63255981-63256003 GGAGGACTGAATGGTTTTATGGG - Intergenic
1109701353 13:66028709-66028731 CCAGGCTCAAATGGTTTTACTGG - Intergenic
1110018277 13:70436629-70436651 ACAGGTCTAGATGGTTTCACTGG + Intergenic
1111152383 13:84272192-84272214 CCAGGCCTAGATTGTTTCATTGG - Intergenic
1111665259 13:91259212-91259234 CCAGGTCTAAAAGGCTGCATTGG + Intergenic
1112167631 13:96936547-96936569 CCAGAACTAAAGGGTTTTCTGGG - Intergenic
1113921018 13:113910295-113910317 CCAGGCCCAGATGGTTTTATTGG - Intergenic
1114304462 14:21409189-21409211 ACAGCTCTAAAATGTTTTATTGG + Intronic
1115889632 14:38012223-38012245 GGAGGACTAAATGGTTTCATGGG + Intronic
1116393847 14:44424271-44424293 TCAGGTCTAATAGGTTTTTTTGG - Intergenic
1116754587 14:48930564-48930586 CCAGGTGTAAACAGTTTTAGAGG + Intergenic
1117687722 14:58271939-58271961 CCAGGGCTAAATAGTTACATTGG - Exonic
1118099915 14:62586355-62586377 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1120614555 14:86687631-86687653 TGAGGTCTATATGCTTTTATTGG - Intergenic
1121040901 14:90746191-90746213 CCAGGTCCAGATGGCTTTACTGG - Intronic
1121707704 14:96011317-96011339 GAAGGACTAAATGGTTTTAAGGG - Intergenic
1123391227 15:19875659-19875681 CCAGGCCCAAATGGCTTTAGTGG + Intergenic
1124385149 15:29201881-29201903 CCAGGTCCAGATGGTTTCACTGG - Intronic
1124553371 15:30703984-30704006 CCAGGCCTAGATGGTTTCACTGG - Intronic
1124677874 15:31701684-31701706 CCAGGCCTAGATGGTTTCACTGG + Intronic
1125368909 15:38948937-38948959 CAAGGTATAAAATGTTTTATGGG - Intergenic
1126211079 15:46101193-46101215 CTAGGTTCAAATGGTTTGATAGG - Intergenic
1126513014 15:49501825-49501847 GGAAGACTAAATGGTTTTATGGG + Intronic
1126553404 15:49958854-49958876 CCAGGTCCACATAATTTTATAGG + Intronic
1127280254 15:57484214-57484236 CCAGGTCTAACTGGTTTCAGTGG - Intronic
1128429102 15:67573975-67573997 CCAGCTCTGACTGGGTTTATTGG + Intronic
1129307579 15:74678469-74678491 CCAGGCCTAGATGGCTTTACTGG + Intronic
1129972558 15:79792473-79792495 CCAGGTGCAAATGGTTTCACAGG + Intergenic
1130392338 15:83468937-83468959 CCAGGCCTAGATGGTTTTACTGG - Intronic
1131780499 15:95851985-95852007 CCAGGCCCAAATGGTTTTACTGG + Intergenic
1132322601 15:100937004-100937026 CCAGGCCTGTATGGTTTTATAGG - Intronic
1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG + Intronic
1132422408 15:101682744-101682766 CCAGGCCAAGATGGTTTTACTGG - Intronic
1133539856 16:6739502-6739524 TCCGGTCTAAATGGTTTCACTGG + Intronic
1134592475 16:15466049-15466071 CCAGGTATAAATGCCTTTTTGGG + Intronic
1136078456 16:27834530-27834552 CCAGGTCCAGATGGTTTTACTGG - Intronic
1137882342 16:52063187-52063209 CCATGGATGAATGGTTTTATAGG - Intronic
1138288099 16:55825133-55825155 CCAGGTCTAACTGTGTATATGGG + Intronic
1139413268 16:66783665-66783687 CCAGGCCTTAATGGTTACATTGG - Intronic
1140127182 16:72127709-72127731 TTAGGTCTAGATGGTTTTATAGG + Intronic
1141147811 16:81543914-81543936 GCAGGTCTGAATCGTATTATCGG + Intronic
1142729456 17:1842294-1842316 CTAGGTCCAGATGGCTTTATTGG - Intronic
1144184368 17:12782943-12782965 CCAGGTCCATATGGTTTTATGGG - Intergenic
1144258572 17:13495359-13495381 CCAGGTCTCAGTGGTTTTCTTGG + Intergenic
1146814868 17:35934637-35934659 CCAGGAATAAATGGTTTTCTTGG - Exonic
1147235344 17:39053071-39053093 CCAGGAATAAATGGTTTTCTTGG + Intergenic
1148944496 17:51247837-51247859 CCAGGCCTAGATGGTTTCACAGG - Intronic
1151191665 17:72402803-72402825 CCAGGACTAAAGGGTTTCTTGGG - Intergenic
1151969601 17:77450907-77450929 GCAGGTCTGAATGGCTTTCTGGG + Intronic
1152692874 17:81728438-81728460 CCAGCTCTAGCTGGTTTTACGGG + Intergenic
1153320341 18:3767280-3767302 CCAGGTCCAGATGGTTTCACAGG + Intronic
1153516547 18:5908337-5908359 GCATGTCTAATTGTTTTTATAGG - Intergenic
1155424512 18:25692403-25692425 CCAGTTCTAGATAGTTTTACAGG - Intergenic
1155856507 18:30840473-30840495 CCAGGACTAGATGGCTTTACTGG - Intergenic
1157854083 18:51088086-51088108 TCAGGCCTAGATGGTTTTACTGG + Intergenic
1158211506 18:55055457-55055479 CCAGGTATAACTGGCTTTATAGG + Intergenic
1158264313 18:55643680-55643702 CCAGGCCCAGATGGTTTTATTGG + Intronic
1158645797 18:59245849-59245871 CCAGACCCAGATGGTTTTATAGG - Intergenic
1159719343 18:71867129-71867151 CCAGCACCAGATGGTTTTATTGG - Intergenic
1160384916 18:78490417-78490439 CCAGGCATACATGGTTTTACAGG + Intergenic
1162011374 19:7817474-7817496 CCAGGCCCAGATAGTTTTATGGG - Intergenic
1163295746 19:16411437-16411459 TCAGGGCTAGATGTTTTTATGGG + Intronic
1164815472 19:31197829-31197851 CCAGCTCTAGATGGCTTTACTGG + Intergenic
1165292691 19:34901244-34901266 GCAGGTCTGAATGATTTTAATGG + Intergenic
1165398253 19:35579743-35579765 TCAGGCCTAGATGGTTTCATTGG + Intergenic
1167331196 19:48857421-48857443 CCGGGCCTCCATGGTTTTATTGG - Exonic
1167883731 19:52483556-52483578 CCTGGTCTGAATGTTTATATTGG - Intronic
1167884631 19:52490036-52490058 CCTGGTCTGAATGTTTATATTGG - Intronic
1167889990 19:52531625-52531647 CCTGGTCTGAATGTTTATATTGG - Intronic
1167926913 19:52828712-52828734 CCTGGTCTGAATGTTTGTATTGG + Intronic
1167989784 19:53348598-53348620 CCTGGTCTGAATGTTCTTATTGG - Intronic
1167993277 19:53378862-53378884 CCTGGTCTGAATGTTTGTATTGG - Intronic
925038567 2:711655-711677 CCAGGACCAGATGGTTTTATTGG - Intergenic
925699571 2:6621838-6621860 CCAGGTGTAAATGGCTTTACTGG - Intergenic
925791713 2:7495450-7495472 CCAGGACTGAATGGCTTTACTGG + Intergenic
926238075 2:11064158-11064180 CCAGGACTAGGTGGTTTCATTGG - Intergenic
926329469 2:11812692-11812714 CCAGGTCTTGTTGGTCTTATAGG + Intronic
927902824 2:26833639-26833661 CCAGGTCCAGATGGCTTTACTGG + Intergenic
928047118 2:27946598-27946620 CCAGGTCCAGATGGCTTCATTGG - Intronic
928587934 2:32780733-32780755 CCAGGTCTAAATTTTATTTTTGG + Intronic
930425132 2:51203488-51203510 ACAGGTTTAGATTGTTTTATAGG - Intergenic
931479315 2:62623823-62623845 CCAGGTCTAGGTGATTTTGTGGG - Intergenic
931504369 2:62908064-62908086 CCAGGTCCACATGGCTTCATTGG - Intronic
931703356 2:64926521-64926543 GGAGGGCAAAATGGTTTTATGGG + Intergenic
932105169 2:68935580-68935602 CCAGGACTAAAGGGTTTCGTGGG + Intergenic
933422280 2:82064695-82064717 CCTGGGCAAAATGGATTTATTGG - Intergenic
933563225 2:83915392-83915414 CCAAGTCTATATGGCTTTATTGG - Intergenic
933583754 2:84157689-84157711 CTAGGCCAAAATGGCTTTATTGG - Intergenic
934126264 2:88894271-88894293 CCAGGCCTAGATGGATTTATGGG - Intergenic
934536508 2:95138894-95138916 GGAGGACTGAATGGTTTTATGGG + Intronic
934878888 2:97954864-97954886 CCAGGCCAAAATGGCTTTACTGG + Intronic
935615478 2:105075456-105075478 CCAGGCCTAGAAGGTTTTGTCGG + Intronic
936273929 2:111075198-111075220 CTAGGCCTTAATGGTTTCATTGG - Intronic
936372593 2:111914998-111915020 CCAGGCCCAGATGGTTTCATTGG - Intronic
936398316 2:112147156-112147178 CCAGGCCCACATGGTTTCATTGG - Intronic
938529263 2:132166401-132166423 CCAGGCCCAAATGGCTTTAGTGG - Intronic
939218090 2:139266087-139266109 CCAGACCTTAACGGTTTTATTGG - Intergenic
939761344 2:146184719-146184741 CCAGGTCTAGATGGTTTTACAGG - Intergenic
941741709 2:169042752-169042774 CCAGGACTAAATGGCTTCACTGG + Intergenic
941894732 2:170617925-170617947 ACAGGTCTAAAGGCTTATATTGG + Intronic
941946055 2:171098513-171098535 CCAGGCCTAGATGGTTTCACTGG + Intronic
942894134 2:181030667-181030689 CCAGGTCCACATAGTTTTACAGG - Intronic
943490386 2:188547078-188547100 CCAGGTGTAGATGGTTTCACTGG + Intronic
943582684 2:189703090-189703112 CAAGGTATGAATGGTTTTATTGG + Intronic
944284311 2:197931231-197931253 CCAGATCTAAACACTTTTATGGG - Intronic
945500677 2:210569679-210569701 GAATGTCTAAATGGTCTTATTGG + Intronic
946902921 2:224389696-224389718 TCATGTTTAAATGGTCTTATAGG + Intronic
947014528 2:225603650-225603672 CCATGTCTCAATGATTTTTTTGG + Intronic
947356807 2:229304740-229304762 CCAGGACCAGATGGTTTTACAGG + Intergenic
948108349 2:235433553-235433575 GCAGGTTTAAATGGTTATAAGGG + Intergenic
1169983555 20:11415449-11415471 CCAGGCCTAGATGGTTTCACTGG - Intergenic
1170416886 20:16153168-16153190 CCAGGTCCACATGGTTTTACTGG + Intergenic
1170754765 20:19190647-19190669 CCAGGCCTAGATGGGTTCATTGG - Intergenic
1171566567 20:26197427-26197449 CCAAGTTTAAATAGTTATATTGG + Intergenic
1172804908 20:37604838-37604860 CCCGATCTAAATGATTTTAAAGG - Intergenic
1176767245 21:13033501-13033523 CCAGGCCCAAATGGCTTTAGTGG + Intergenic
1177796670 21:25785884-25785906 CCAGGGCTAGATGGTTTCACTGG - Intergenic
1180514374 22:16127731-16127753 CCAGGCCCAAATGGCTTTAGTGG + Intergenic
1180763329 22:18225062-18225084 CCAGGACCAAATGGTTTTACTGG + Intergenic
1180772317 22:18399482-18399504 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180803696 22:18649098-18649120 CCAGGACCAAATGGTTTTACTGG - Intergenic
1180807068 22:18720348-18720370 CCAGGACCAAATGGTTTTACTGG + Intergenic
1180978466 22:19865819-19865841 CCAGGCCCAGATGGTTTCATTGG - Intergenic
1181218023 22:21346159-21346181 CCAGGACCAAATGGTTTTACTGG + Intergenic
1181599924 22:23944381-23944403 CCAGGACCAGATGGTTTTACTGG + Intergenic
1181816606 22:25442261-25442283 CCAGGCTTAGATGGTTTTACTGG + Intergenic
1182583602 22:31329824-31329846 CCAAGTCAAAATCCTTTTATCGG - Intronic
1185189022 22:49421694-49421716 CCAGATCCAGATGGTTTTAGAGG + Intronic
1203234157 22_KI270731v1_random:140471-140493 CCAGGACCAAATGGTTTTACTGG - Intergenic
949453097 3:4209094-4209116 CCAGGTCTAGATGTTTTAACTGG - Intronic
949633780 3:5959925-5959947 CCAGGACCAGATGGTTTCATGGG - Intergenic
950705909 3:14781459-14781481 CCAGGTCCATATGGTTTTACAGG + Intergenic
952445721 3:33378956-33378978 CCAGATCCAGATGGTTTTGTTGG + Intronic
952564927 3:34643585-34643607 CCAGGTCAAGATGGTTTTATTGG + Intergenic
952616434 3:35278672-35278694 GCTGGTCTAAATGCATTTATAGG - Intergenic
953831972 3:46306904-46306926 CCAGGTCTATATGGTTTCACTGG - Intergenic
954605459 3:51905956-51905978 CCAGGAGAAAATGGTTTCATGGG + Intergenic
955031185 3:55221021-55221043 GCAGTTCTAAATGTTTGTATGGG - Intergenic
955999930 3:64718511-64718533 CCAAGTTTAAATGGTATCATGGG - Intergenic
956676093 3:71733164-71733186 CCAGGACCAAAGGGTTTTCTGGG - Intronic
957111577 3:75967132-75967154 CCAAGTTTAAATAGTTATATTGG - Intronic
957694725 3:83620018-83620040 CAAGGACTAGATGGTTTTCTTGG + Intergenic
957953197 3:87150367-87150389 CGAGGGAAAAATGGTTTTATGGG - Intergenic
959147124 3:102561456-102561478 CCAGGACCAAATGGTTTCATAGG - Intergenic
959727945 3:109565658-109565680 CCAGGCCCAAATGGTTTCACAGG - Intergenic
960630015 3:119720554-119720576 CCAGGCCTAAACAGTTTTACAGG + Intronic
960774714 3:121236850-121236872 CAAGGTAAAAATGGTTGTATAGG + Intronic
960867400 3:122215774-122215796 TCAGGTATAATTGGTTTTCTTGG + Intronic
961359735 3:126359478-126359500 CCAGGCCCAAATGGTTTTATAGG - Intergenic
962292980 3:134152965-134152987 CCAGGTCTATAGGTTTTAATGGG - Intronic
965112118 3:164439845-164439867 CCAGGACCATATGGCTTTATTGG + Intergenic
965151050 3:164975191-164975213 TCAGGCCTAGATGGTTTCATTGG + Intergenic
965296853 3:166957489-166957511 CCAGGTTTAGATGGTTATATAGG + Intergenic
965367381 3:167817453-167817475 CCAAGCCTAGATGGTTTTCTAGG - Intronic
965646398 3:170886247-170886269 CCAGGTCCAAATGGTTTCACAGG - Intergenic
966381047 3:179345786-179345808 CCAGGTCTAGATGATTTTCGGGG - Intergenic
968856028 4:3123099-3123121 CCAGGCCTGAATAGTTTTGTAGG + Intronic
969050141 4:4367009-4367031 CCAGGCCCAGATGGTTTTGTTGG + Intronic
969833809 4:9821841-9821863 CCAGGTCCACATGGTTTCAGTGG - Intronic
970336342 4:15048323-15048345 CCAGGCCTAGATGGCTTTACTGG - Intronic
971831883 4:31705111-31705133 CCAGGAGAAAATGGTTTCATGGG - Intergenic
972443781 4:39123247-39123269 CCAGGACTAAATGAGTTTACTGG + Intronic
973215037 4:47658643-47658665 GGAGGACTGAATGGTTTTATGGG - Intronic
973904520 4:55514995-55515017 CCAGGTCCAGATGGGTTCATTGG - Intronic
974217466 4:58869180-58869202 CCAGGTCCACATGGTTTTACTGG + Intergenic
974795435 4:66742822-66742844 CCAGGCCAAAATGGCTTTACTGG + Intergenic
975920217 4:79378077-79378099 ATAGGTCTTGATGGTTTTATGGG + Intergenic
976060394 4:81121408-81121430 CCAGGCTTAGATGGGTTTATTGG - Intronic
978426732 4:108591201-108591223 GTAGATCTAAATGGTTTTCTGGG + Intergenic
978451403 4:108838150-108838172 CCAGGGTTAAATGGTGTTAAAGG - Intronic
979383929 4:120041739-120041761 CAAGGTCTAAATGGACTAATGGG - Intergenic
979420048 4:120493099-120493121 CCAGGTCTAAATGATTTCACTGG - Intergenic
979443932 4:120788198-120788220 CCAGGTTTATATCTTTTTATGGG - Intronic
979881709 4:125967931-125967953 CCAGGGATCAATGGTTTTGTGGG - Intergenic
979973031 4:127161224-127161246 CATGGTATAAATGGTTCTATGGG - Intergenic
980181238 4:129403755-129403777 ACAGATCATAATGGTTTTATAGG - Intergenic
981762117 4:148206044-148206066 CCAGGTCTAATTTGTGTTTTGGG + Intronic
982416398 4:155137603-155137625 CCAGGCCCATATGGTTTTAATGG - Intergenic
982478412 4:155879551-155879573 GGAGGAATAAATGGTTTTATGGG - Intronic
982602085 4:157464884-157464906 CCAGGACCAGATGGTTTCATTGG + Intergenic
983978909 4:173970266-173970288 CCAGGACAAAATGGTTTCACTGG - Intergenic
985223702 4:187735997-187736019 CCAGGTCCAGATGGATTTACTGG + Intergenic
985515209 5:340143-340165 CCAGGTCTAAATGGTTTCACTGG - Intronic
986423893 5:7611638-7611660 CCAAGTCTAAATGCATTTCTGGG - Intronic
988490405 5:31700811-31700833 CCAGGTCTGAAAGGTTTCCTGGG - Intronic
991232964 5:64358593-64358615 ACAGGCCCAAGTGGTTTTATAGG + Intronic
991923079 5:71676968-71676990 CTAAGTCTAAAAGGTTTTCTTGG + Intergenic
992280197 5:75167235-75167257 ACAGGTCTTAATTGTTTTATGGG - Intronic
992991011 5:82283457-82283479 CCAGGCCCCAATGGTTTTACAGG - Intronic
994793435 5:104262160-104262182 CCAGGTTTAGATGGATTCATGGG + Intergenic
994834082 5:104826991-104827013 CCAGGCCCAGATGGTTTTACAGG - Intergenic
995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG + Intergenic
996015256 5:118526502-118526524 CCACATCAAAATGGTTTTAACGG + Intergenic
999541451 5:152577804-152577826 CCAGGCCCAAATGGTTTCACTGG - Intergenic
999605668 5:153312755-153312777 CCAAGCCTAAATGGCTTTACTGG - Intergenic
999806890 5:155089641-155089663 CCTGGTCTAAATAGTGTTAGAGG - Intergenic
1000061596 5:157661955-157661977 CCAGGCCTCCATGGTTTTATTGG - Intronic
1000140074 5:158394631-158394653 CCAGGTCTCACTTGCTTTATTGG - Intergenic
1000442356 5:161279106-161279128 CCATGTCCAGATGGTTTCATTGG - Intergenic
1000741434 5:164974604-164974626 TAAGGTAAAAATGGTTTTATGGG + Intergenic
1001504574 5:172267272-172267294 CCAGGTCAAAATGATTGTAAAGG + Intronic
1002448541 5:179306009-179306031 CCAGGTCTAGACGGTTTTACTGG + Intronic
1004625157 6:17368352-17368374 TCAGGTCCAAGTGGCTTTATTGG - Intergenic
1004751684 6:18568286-18568308 GCAGGTATAAATGTTTTTTTGGG + Intergenic
1005171102 6:22985809-22985831 TCAGGCCTAGATGGTTTCATTGG - Intergenic
1005608612 6:27501072-27501094 CCAGGCCTAGATGGCTTCATTGG + Intergenic
1006529077 6:34634807-34634829 CCAGGTTTGAATGGTTTTGCTGG + Intronic
1007055436 6:38879117-38879139 CCAGGCCAAGATGATTTTATTGG + Intronic
1007062145 6:38950737-38950759 CCAGGGCTACTTAGTTTTATTGG + Intronic
1009709847 6:67303185-67303207 CCAGGGCTTAATGGTTTCATTGG - Intergenic
1010347760 6:74832253-74832275 CCAGGTCTAGATGGTTTCATAGG - Intergenic
1010719445 6:79265524-79265546 CCAGGACCAGATGGTTTTACTGG + Intergenic
1010803638 6:80208806-80208828 CCAGGCCTAAATGGCTTTATTGG + Intronic
1011464377 6:87640179-87640201 CCAGGTTTCAACAGTTTTATTGG - Intronic
1011924940 6:92630759-92630781 CCAGATTTAAATGGGTTTACTGG - Intergenic
1014716942 6:124877236-124877258 CCAGGTCCAAATGGTTTCACTGG - Intergenic
1017189510 6:151636747-151636769 CAGGGTCCAAATAGTTTTATAGG - Intergenic
1017899449 6:158706419-158706441 CCATATGTAAATGGTTTTTTTGG + Intronic
1018665321 6:166131059-166131081 CCAGGGCCAAATGGCTTTACTGG + Intergenic
1019027749 6:168985371-168985393 CAAAGTCAAGATGGTTTTATAGG + Intergenic
1019090264 6:169525234-169525256 CCCGGTTAAAATGCTTTTATCGG + Intronic
1020012166 7:4811817-4811839 CAAGGTCCAGATGGTTTCATTGG - Intronic
1020351488 7:7224426-7224448 CCAGGTCCAGATGGTTTTACTGG - Intronic
1021232069 7:18097535-18097557 CCAAGTTTAAATGGTTTATTAGG - Intronic
1021793765 7:24232459-24232481 CCAGGCCCAAATGGTTTGGTGGG + Intergenic
1021973889 7:25992346-25992368 CCAGGCCTAGATGGCTTCATTGG + Intergenic
1023213012 7:37828957-37828979 GCAGGTTTAAATAGTTTTACTGG + Intronic
1024203949 7:47136749-47136771 CCAGGTCCATATGGCTTTACTGG - Intergenic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1026531391 7:71200455-71200477 ACTGGTGTAAATGGTTTTAATGG + Intronic
1027169168 7:75858373-75858395 CCAGGACCAGATGGTTTTATTGG - Intronic
1027492158 7:78841740-78841762 CCAGGTTTAAATGGTTATCCGGG + Intronic
1028254869 7:88582397-88582419 CCAGATCTATTTGGCTTTATGGG - Intergenic
1029038198 7:97544835-97544857 CCAGGTATAGATGGTTTCACTGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1029800232 7:102939169-102939191 ACAGGTCTTAATGGCTTTATAGG + Intronic
1030180328 7:106700870-106700892 CCAGGCCTAGATGGGTTTACTGG - Intergenic
1030774625 7:113518618-113518640 ACAGTTTTAAATGGTTTTAAAGG - Intergenic
1031092476 7:117376330-117376352 CCAGGTCCAGATGGTTTCACTGG + Intronic
1031284141 7:119843017-119843039 GCAGGTAAAAATGGTTTCATGGG + Intergenic
1032106094 7:129031577-129031599 CCAGGACCAAATGGCTTTACTGG + Intronic
1032860298 7:135871910-135871932 CCAGGCCCATATGGTTTTACAGG - Intergenic
1032863250 7:135901898-135901920 CCAGGAATAAATGCATTTATGGG - Intergenic
1033052200 7:138015637-138015659 CCAGGTCCAAATGGTTCCATAGG - Intronic
1033063494 7:138129739-138129761 GCAGGACTGAATGGTTTTGTGGG - Intergenic
1033093764 7:138411572-138411594 CCAGCTCAAAATGGATTAATTGG - Intergenic
1033817352 7:145089830-145089852 CCAGGTCTGAATGGCTTTGCTGG - Intergenic
1034363092 7:150519704-150519726 CCAGGTATAGATGGTTTCACAGG - Intronic
1035091173 7:156312566-156312588 CCAGGTCTAGATGGCTTCATGGG - Intergenic
1038171563 8:25138918-25138940 CCAGGCCTAAATAGCTTTACTGG + Intergenic
1038339400 8:26672020-26672042 CTAGGTCCAAATGGTTTCAATGG - Intergenic
1038371580 8:26998347-26998369 CCAGGCCTAGATGGCTTCATTGG - Intergenic
1038656500 8:29457354-29457376 CCAGGCCTAAATAGTTTTATTGG + Intergenic
1038806329 8:30795689-30795711 CCAGGTGTAAATAGTTTTATAGG - Intronic
1039214071 8:35250052-35250074 AAAAGTTTAAATGGTTTTATTGG + Intronic
1041069624 8:54114270-54114292 TCAGGCCTAAATGGCTTTACTGG - Intergenic
1041185191 8:55292265-55292287 CCAGGTCTAAATGGTTTTATTGG - Intronic
1041563923 8:59253563-59253585 CTAGGTCTAAATGGGTTCACTGG - Intergenic
1043325451 8:79045254-79045276 TCAGGTCTAGACGGTTTCATTGG + Intergenic
1045715665 8:105041504-105041526 TCAGGCCTAGATGGCTTTATAGG + Intronic
1046834821 8:118788597-118788619 ACAGGTCTCAATCATTTTATAGG - Intergenic
1047392216 8:124461648-124461670 CCAGGTCCAAATAGCTTCATTGG - Intronic
1049561272 8:143311999-143312021 CCAGGCCTAGATGGTTTCACTGG + Intronic
1050440458 9:5656319-5656341 CCAGGACTAAATGTGTTCATAGG - Intronic
1051843571 9:21426220-21426242 CCAGGTCCAGATGGATTTACAGG - Intronic
1053543996 9:39003832-39003854 ACAGGTCAAAATGGTGTTAATGG + Intergenic
1053808430 9:41827329-41827351 ACAGGTCAAAATGGTGTTAATGG + Intergenic
1054622162 9:67360099-67360121 ACAGGTCAAAATGGTGTTAATGG - Intergenic
1055049865 9:71968388-71968410 CCAGGCCCAAATGGCTTTACTGG - Intronic
1056225750 9:84493581-84493603 CCAGGTGTATGTGGTTTAATGGG - Intergenic
1056444415 9:86652003-86652025 CCAGGTCCAGGTGGTTTCATTGG - Intergenic
1057066996 9:92063399-92063421 CCAGGCCCAGATGGTTTCATGGG + Intronic
1057423537 9:94930491-94930513 CAAGATTTAAAGGGTTTTATAGG - Intronic
1057795529 9:98154284-98154306 CTAGGCCTAGATGGTTTTACAGG - Intronic
1057993131 9:99794099-99794121 CCAGGTCCATATGGTTTCTTTGG - Intergenic
1058503325 9:105645095-105645117 GCAGATCTATAGGGTTTTATGGG + Intergenic
1058823383 9:108753518-108753540 TCAGGTCTAGATGATTTCATAGG + Intergenic
1059016632 9:110524177-110524199 CCAGGTCCAAATGATTTCAGTGG + Intronic
1059172489 9:112139121-112139143 CCACATCCAGATGGTTTTATAGG + Intronic
1059621759 9:116013425-116013447 CCAGGTCTGTATGGATTGATAGG - Intergenic
1059822622 9:117990835-117990857 CCAGGTCTTGATGGTTTTCTTGG + Intergenic
1059885054 9:118736594-118736616 GGAGGACTAAATGGTTTTGTGGG + Intergenic
1060233551 9:121843299-121843321 ACAGGTCTCAATGGTTTTTAGGG - Intronic
1187605512 X:20878121-20878143 CCAGGTCCAGATGGATTTACAGG + Intergenic
1187914300 X:24139145-24139167 CCAGGCCCAGAGGGTTTTATAGG + Intergenic
1187975872 X:24704300-24704322 GCAGGTATAAAAGGTTTTTTTGG + Intronic
1188169000 X:26898166-26898188 GCAGGTTCAAATTGTTTTATTGG + Intergenic
1188202879 X:27314151-27314173 CCAGATCCAAATGGTTTCACTGG + Intergenic
1188246809 X:27845554-27845576 CCAGGTGCAGATGGTTTTCTTGG - Intergenic
1188418899 X:29972543-29972565 CAAGGTCTATATGGTTTTGGGGG + Intergenic
1188500214 X:30817554-30817576 CCAGGACTACATGGCTTTAGTGG + Intergenic
1189082057 X:37984516-37984538 CCAGGCCCAAATGGCTTCATTGG + Intronic
1189626545 X:42903261-42903283 CCAGGTCTAGCTTGTTTTCTGGG + Intergenic
1189687290 X:43578217-43578239 CCAGGACCAAATGGTTTGCTGGG + Intergenic
1190024137 X:46907254-46907276 CCAGGTCCACATGGTTTCACTGG + Intergenic
1190146784 X:47899695-47899717 CTAGGTCCAAATGGCTTTCTTGG - Intronic
1190341007 X:49295730-49295752 CCAGGTCCAGATGGTTTCACTGG - Intronic
1190538298 X:51450777-51450799 CCAGGTCTAGATGGATTTACTGG - Intergenic
1191744539 X:64471785-64471807 CCAGGACCAAGTGGCTTTATTGG - Intergenic
1192545937 X:72013927-72013949 CCAGGTCCAGATGGTTTCACTGG - Intergenic
1192627432 X:72744925-72744947 CCAGGTCTATATGGTGTTTGGGG - Intergenic
1192654276 X:72975888-72975910 CCAGGTCTATATGGTGTTTGGGG + Intergenic
1193521858 X:82540195-82540217 CCAGGCCCTAATGGTTTCATTGG - Intergenic
1195406341 X:104518230-104518252 CCAGGCCTAAATGGTTTTACTGG - Intergenic
1195545194 X:106105988-106106010 CTAGGAGAAAATGGTTTTATGGG + Intergenic
1195634133 X:107094097-107094119 CCAGGTCCAAATGGCTTCATTGG + Intronic
1196072200 X:111538611-111538633 CCAGGTCTATATGGCTTCACTGG + Intergenic
1196526567 X:116734822-116734844 TCAGGTCTACAGGGTTTTATGGG - Intergenic
1199431798 X:147770011-147770033 TCAGGTCCAGATGGTTTTACTGG - Intergenic