ID: 1041192996

View in Genome Browser
Species Human (GRCh38)
Location 8:55372335-55372357
Sequence CTGGCTAAAGGTCAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041192996 Original CRISPR CTGGCTAAAGGTCAGGTGAA TGG (reversed) Intronic
901064864 1:6489832-6489854 CCGGCTAAAGGGCAGGAGAATGG + Intronic
902098915 1:13968648-13968670 CTGCTGAAAGGTCACGTGAAAGG - Intergenic
903239748 1:21974847-21974869 CTGGCGTAAGGTCTGGGGAATGG + Intergenic
904684682 1:32251497-32251519 CTCGCTCAAGGTCAGGTGGGAGG + Intronic
904929702 1:34077051-34077073 CTGGAGAAAGGTGAGGTTAAAGG + Intronic
906606145 1:47173745-47173767 CTGGCTAGAAGTCAGGTGTTCGG - Intergenic
911054535 1:93698762-93698784 GTGGCCTAATGTCAGGTGAAAGG + Intronic
913058839 1:115186411-115186433 TGGACCAAAGGTCAGGTGAAAGG + Intergenic
917646473 1:177033668-177033690 CTTACTAAAGCTCAGGGGAAGGG + Intronic
918058115 1:181039984-181040006 CTGGTTAATGGACAGGTTAAAGG + Intronic
920123538 1:203676151-203676173 TTGGCTAAAGTTCAGGTGGCGGG - Intronic
920957840 1:210635463-210635485 CTATCTAGAGGTCATGTGAAGGG + Intronic
922343575 1:224677419-224677441 CTGGCTGAATGTTAGGTGAATGG + Intronic
924616200 1:245613951-245613973 GGGGCTAGAGGTCAGGGGAAGGG - Intronic
1063276365 10:4572698-4572720 CTGCCAAGAGGGCAGGTGAAAGG + Intergenic
1066967919 10:42286715-42286737 TTGGCTACAGGTCAGGGGGATGG - Intergenic
1067836264 10:49643712-49643734 CTGGCTAATGGGAAGGGGAAAGG - Intronic
1069597584 10:69682376-69682398 TTGGATAAAGGTCAGTTGCATGG - Intergenic
1070440341 10:76436727-76436749 ATGGCTAAAGATAAAGTGAATGG - Intronic
1071111441 10:82162236-82162258 ATAGCTAAAGGAGAGGTGAATGG + Intronic
1071309275 10:84328153-84328175 CTTGCTAAAGCTGAGGGGAAGGG - Intergenic
1074782249 10:116810347-116810369 ATGGCCAAAGGTCAGTTAAATGG - Intergenic
1076541723 10:131219282-131219304 CTGGCTCAAGGACAGGGGACAGG - Intronic
1077436780 11:2543943-2543965 CTGGCAAAAGGACAGATCAACGG - Intronic
1077739121 11:4825649-4825671 CTGGATGAAGTTCAGGTGGAAGG - Intronic
1078970732 11:16408074-16408096 CTTGCTAAAGACCAGGTGAGAGG - Intronic
1079572157 11:21956661-21956683 CTGGCTAAAGGTTTGTTAAAAGG - Intergenic
1080147139 11:28999943-28999965 CTATCTAAATGTTAGGTGAAAGG + Intergenic
1081029002 11:38054139-38054161 CTGACTGAAGGGTAGGTGAAAGG - Intergenic
1081354151 11:42092343-42092365 CTAGCTAAATGACAGGAGAAGGG - Intergenic
1084333675 11:68444977-68444999 CTTCCTAAAGGGCAGGGGAAGGG + Intronic
1085802457 11:79602977-79602999 CTGACTAAAGGACAGGTGGTTGG + Intergenic
1086313621 11:85565509-85565531 GAGGCTAAGGGTCAGGGGAATGG - Intronic
1087010553 11:93510151-93510173 CTGAGTACAGGTCTGGTGAAGGG + Intronic
1089708592 11:120298926-120298948 CCTGCTAAATGGCAGGTGAAGGG - Intronic
1089940282 11:122409506-122409528 CTGGCTAATGATCAGGTGGCAGG - Intergenic
1091104701 11:132907701-132907723 CAGGGTAAAGGTCATTTGAAGGG - Intronic
1091569037 12:1668585-1668607 CTGGTTAAATGTCTAGTGAAAGG - Intergenic
1092311602 12:7361624-7361646 CTGGCCAGAGGACAGGGGAAGGG - Intronic
1095548571 12:43403605-43403627 CTGGGTAAAGGTAAGATGAAAGG + Intronic
1101132357 12:101702356-101702378 CTAGCTTAAGGTCAGGTCAAAGG + Intronic
1103354735 12:120311412-120311434 CTGGCTCAAGCTCTGGTGATTGG + Intronic
1103419707 12:120770561-120770583 CTGCCTAAAGGTCGGGTAAGAGG - Intronic
1103934738 12:124469127-124469149 CTGGCCCAAGGTCAGATGGAAGG + Intronic
1104035197 12:125092854-125092876 CTGGCTCAAGGTCGGCTGAGGGG - Intronic
1104682226 12:130759984-130760006 CTTACTAAAAGTCAGGTGACGGG + Intergenic
1104929702 12:132331919-132331941 CTTGCTCAAGGTCGCGTGAATGG + Intergenic
1105609179 13:21952868-21952890 CTGGCTAGGGGTCAGGGGCAAGG + Intergenic
1108343606 13:49522166-49522188 CAGTCTGAATGTCAGGTGAAAGG + Intronic
1108478928 13:50847340-50847362 CTGTAGAAAGGTTAGGTGAATGG - Intergenic
1108776853 13:53776124-53776146 CTGGCTGAAGGACAGGAAAAAGG + Intergenic
1109886339 13:68550640-68550662 CTGGCTAAATGTCACATAAATGG + Intergenic
1111561534 13:89955473-89955495 CTGGTTAAAGGTCTGGTAATTGG - Intergenic
1113439476 13:110316502-110316524 CTGGCTCCAGATTAGGTGAAAGG + Intronic
1115714415 14:36086780-36086802 CTAGCCAAAGTTCAAGTGAAAGG - Intergenic
1116429472 14:44829260-44829282 CTGGATTAAGGTCTGCTGAAGGG - Intergenic
1119439971 14:74621662-74621684 CTGGCCCAAGGTCATGTGACTGG + Intergenic
1120002713 14:79321218-79321240 ATGACTAAAGGTCCAGTGAAAGG + Intronic
1120642354 14:87030440-87030462 CTGGGGAAAGGACAGGTGAAAGG - Intergenic
1122647650 14:103206058-103206080 CAGGCTCAAGGGCAGGTGAAGGG - Intergenic
1125514411 15:40309650-40309672 ATGGCTACAGGACAGATGAAAGG - Intergenic
1126351588 15:47750166-47750188 CAGCCTCAAGGTCAGGGGAATGG + Intronic
1127129815 15:55850707-55850729 CTGGCTTGAGGTCAGCTGACTGG + Exonic
1128428670 15:67569986-67570008 CAGCCTAAAAATCAGGTGAAAGG + Intronic
1134156895 16:11851400-11851422 CTGGATAAAGAACAGGTGAGTGG - Exonic
1136123465 16:28157876-28157898 CAGGAGAATGGTCAGGTGAAAGG - Intronic
1136734013 16:32446232-32446254 TTGGCTACAGGTCAGGGGGATGG - Intergenic
1139323276 16:66132649-66132671 CAGGCTTGAGGTCAGGTGAGAGG + Intergenic
1140657414 16:77155047-77155069 CTGGCTAAAGGTCAGGGTCCTGG + Intergenic
1140881376 16:79200810-79200832 CTGGCTAAAGGAGAGGTGCTGGG + Intronic
1141984829 16:87572898-87572920 CTGGCTGAAGGTCAGGGGGCAGG - Intergenic
1142422661 16:89981909-89981931 CTGGCCAGAGGTCTGGTGAGAGG + Intergenic
1203019069 16_KI270728v1_random:383367-383389 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1203037404 16_KI270728v1_random:656525-656547 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1143419147 17:6775792-6775814 GTGGATAAGGGCCAGGTGAAGGG + Intergenic
1147484378 17:40797905-40797927 CTGACTAAATGTCAGGTTGATGG + Intronic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1148941828 17:51221071-51221093 CTGGCTCAAGGCCAGGAGTATGG + Intronic
1149920875 17:60658200-60658222 CTGCCTAAAGGTCAGTTATAAGG - Intronic
1150121701 17:62608788-62608810 AGGGTTAAACGTCAGGTGAATGG + Intronic
1150227053 17:63529992-63530014 CTGAGTGAAGGTCAAGTGAAGGG - Intronic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150293830 17:63997615-63997637 CTTGCTTAAGAACAGGTGAAGGG - Intergenic
1150456075 17:65307904-65307926 CTGGCTCAAGCCCAGTTGAAAGG + Intergenic
1151656028 17:75496413-75496435 CTGGCGAAAGGTCAGGGAACAGG - Exonic
1152615454 17:81335875-81335897 CTGCCCAAAGGCCAGGTGAGAGG - Intergenic
1154132346 18:11748103-11748125 CTAGAAAAAGGTCAGGTGATTGG + Intronic
1156804563 18:41162122-41162144 CTGGGCAAAGGTGAGATGAAAGG + Intergenic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1157156015 18:45266822-45266844 CTTGCTATAGGTCAGGGGTAAGG + Intronic
1157204496 18:45687159-45687181 CTGGCTAGAGGTCAGAGGCATGG + Intergenic
1157307524 18:46528108-46528130 CTGGCTGAGGGTCAGGTTTAAGG + Intronic
1159026543 18:63187633-63187655 CTGAATAAAGAACAGGTGAAGGG + Intronic
1163737726 19:18991712-18991734 TTGGCCATGGGTCAGGTGAATGG - Intronic
1165427208 19:35752824-35752846 CTGGCAAAAGGTAAGGTGGCAGG + Exonic
1165756233 19:38294756-38294778 CTGGGTAAAGATCAGGACAAAGG + Intronic
1166625948 19:44356355-44356377 CTGGTTGATGGTCAGGGGAAAGG + Intronic
1167599418 19:50445702-50445724 CGGGTCACAGGTCAGGTGAAGGG - Intronic
1168317003 19:55488845-55488867 TTGGCTAAAGGTCAGATGTCTGG - Intronic
926597345 2:14805680-14805702 GTGGCTAAAGCACTGGTGAAGGG - Intergenic
930189562 2:48443435-48443457 CTGGCTAAAAGTCAGGACAAAGG + Intronic
930683979 2:54288086-54288108 CTGGATAGAGGAAAGGTGAAGGG - Intronic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932961080 2:76413465-76413487 CTTACTAAAGTTCTGGTGAAAGG - Intergenic
933096280 2:78186582-78186604 CTGGGTAGAGGTCAGTAGAAAGG + Intergenic
933106001 2:78326258-78326280 CTGGATAAAGGACCGGAGAATGG + Intergenic
933599734 2:84317282-84317304 CTGGAGAAAGGACTGGTGAAGGG + Intergenic
934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG + Intergenic
934202060 2:89894279-89894301 CTTTCTGAAGGGCAGGTGAAGGG - Intergenic
934311731 2:91873193-91873215 TTGGCTACAGGTCAGGGGGATGG + Intergenic
934888668 2:98046989-98047011 CTGGATAAAGGTAAAGTGATTGG + Intergenic
938547497 2:132347793-132347815 CTGGCTGATGGTCAGGGGAAAGG - Intergenic
941598080 2:167503357-167503379 CTGGCTGTTGGTCAGGTGAAGGG - Intergenic
942174778 2:173322579-173322601 CTGGCTAAAGATTAGAAGAAGGG + Intergenic
943347718 2:186759520-186759542 TTGGATAAAAGTCATGTGAACGG + Intronic
946856515 2:223955661-223955683 TTGGGTTAAGGTCAGGTGGAAGG - Intergenic
946866091 2:224042235-224042257 CTGGCTAAACTCCAGGTCAAAGG - Intergenic
1169109488 20:3022679-3022701 CTGGCTACAGTGCAGGTGTAGGG + Exonic
1169152384 20:3299732-3299754 CTGGCAAAAGGTCAGGCATATGG - Intronic
1171149716 20:22816599-22816621 CTGGCTAAAAGACAGAGGAAGGG + Intergenic
1171238897 20:23549357-23549379 CTTGCTGGAGGTCAGGTGGAAGG - Intergenic
1171266508 20:23776010-23776032 CTTGCTAATGGTGAAGTGAAGGG + Intergenic
1171876364 20:30580548-30580570 CTGGCTGATGGTCAGGGGAAAGG - Intergenic
1172490438 20:35332316-35332338 CTGGGTAAAGGAGAGCTGAAAGG + Intronic
1174402098 20:50281673-50281695 CTGTTTGAAGGTCAGGTCAATGG + Intergenic
1175470892 20:59226930-59226952 CTGTCCTAATGTCAGGTGAATGG - Intronic
1175757993 20:61542007-61542029 CAGGCTCAAGGTCAGTTAAATGG - Intronic
1179540549 21:42080725-42080747 CTGGATAAAGAACATGTGAAAGG - Intronic
1179902199 21:44400062-44400084 ATAGCTTGAGGTCAGGTGAAAGG + Intronic
1180538480 22:16419010-16419032 TTGGCTACAGGTCAGGGGGATGG + Intergenic
1182345882 22:29664459-29664481 GTAGCTAAAAGGCAGGTGAAGGG - Intronic
1182702027 22:32248130-32248152 CTAGCAATAGGCCAGGTGAAGGG + Intronic
1184208428 22:43020487-43020509 CTGGCAAAAGGTAAGATGATTGG - Intergenic
953128659 3:40116217-40116239 CTGGCTAAAGGTAAAGTGCTAGG - Intronic
954394713 3:50287421-50287443 GTGGCCCAAGGTCAGGGGAAGGG + Exonic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
956501875 3:69895680-69895702 GTGGGTATAGGACAGGTGAAGGG + Intronic
963153517 3:142071783-142071805 TGGGATAAAGGGCAGGTGAAGGG + Intronic
963468752 3:145713486-145713508 CTGGTTTTAGGACAGGTGAAAGG - Intergenic
968642715 4:1722341-1722363 CTGGGTACAGGGCAGGGGAAGGG - Intronic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
973287035 4:48430082-48430104 CTGGCCAGAGGACAGGGGAATGG + Intergenic
975017876 4:69446483-69446505 CTTGCTAAAGTTCAAGGGAAAGG - Intergenic
976454633 4:85231993-85232015 CTGGTTCAATGTCAGGGGAAAGG - Intergenic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
977714562 4:100167386-100167408 CTGGCTTAAGGCCAGATGTAGGG - Intergenic
978615235 4:110587589-110587611 CTGGTTAAAAGTCAAGGGAAGGG - Intergenic
979595611 4:122531056-122531078 GTGGCTAATGGTCAGCTGAATGG - Intergenic
983092745 4:163523980-163524002 CTTGCAAAAGCTCAGGGGAATGG - Intergenic
983831929 4:172338779-172338801 CTGCCTAAAGGTTACCTGAAGGG + Intronic
989120138 5:37996973-37996995 CTGGCTAACAGTCAGGAGATGGG + Intergenic
990916848 5:60915821-60915843 CTGTCTTGAGGTCAGGTGATTGG + Intronic
994102041 5:95903963-95903985 CTTGCTAACGGTTAGGTGTAGGG - Intronic
996162868 5:120187820-120187842 CTGGCTAAATTTTAGGTGGAGGG + Intergenic
996270361 5:121597128-121597150 CTGGCTAACCGACAGATGAAAGG - Intergenic
996452853 5:123646640-123646662 GTGGTTAAAAGTCAGGTAAAAGG - Intergenic
1000400877 5:160825809-160825831 CTGACTACTGGTCAGGGGAAGGG - Intronic
1001873719 5:175181152-175181174 CTGGTTTAGGGTTAGGTGAATGG - Intergenic
1004821155 6:19369164-19369186 CAGGCAAAAGGTCAGGGTAAAGG + Intergenic
1005891055 6:30138701-30138723 CTGGATTAGGGTCAGGGGAAAGG - Intronic
1006197187 6:32251971-32251993 TTGGCTAGAGCACAGGTGAAGGG + Intergenic
1006197227 6:32252402-32252424 TTGGCTAGAGCACAGGTGAAGGG + Intergenic
1007055344 6:38877636-38877658 CTGGCTAGAAGTCAGCTGAGTGG - Intronic
1008268271 6:49459309-49459331 CTGGCTAAAAAGCAGCTGAAAGG - Exonic
1008451571 6:51657165-51657187 CTGGCTTAAGGTCAGTTCATGGG + Intronic
1010550346 6:77214266-77214288 CTGGTTGCAGGTGAGGTGAATGG + Intergenic
1011207761 6:84918682-84918704 GTGGCTAAAATTCAGGTGACAGG + Intergenic
1014751343 6:125260280-125260302 CTGGGAACAGGTCAGGGGAAGGG - Intronic
1015083998 6:129265300-129265322 CTGGCTAAAAGAGAGGTGTAAGG + Intronic
1016345221 6:143105917-143105939 ATGCCCAAAGGTCTGGTGAATGG + Intronic
1017690727 6:156961547-156961569 AGGGCTGAAGATCAGGTGAACGG - Intronic
1021258362 7:18422632-18422654 CTGGCAATAGGTCATGGGAAAGG + Intronic
1022629592 7:32072080-32072102 CTTTGTTAAGGTCAGGTGAATGG - Intronic
1023885435 7:44350495-44350517 CTGGCCAAAGGACTGGGGAAAGG + Intergenic
1024000270 7:45184990-45185012 CTGGCCAAGGCTCAGGTGATGGG - Intronic
1026079059 7:67200930-67200952 ATGGCTGAAGGTCAAGAGAAGGG + Intronic
1026697767 7:72611008-72611030 ATGGCTGAAGGTCAAGAGAAGGG - Intronic
1028773783 7:94656452-94656474 CTGGCGAAAGGTCCGCTGAGCGG + Exonic
1030270579 7:107664565-107664587 CTGGCTTAAGGAAAAGTGAAGGG + Intronic
1033909923 7:146250379-146250401 CTGGCTAAAGGTCAGTGCAGTGG - Intronic
1033912116 7:146276771-146276793 CTTGCTAAAGCTCAGATGATAGG - Intronic
1037058077 8:14469712-14469734 TTGGCTAAAGGTTAAGTTAACGG + Intronic
1038138643 8:24818657-24818679 ATGGCTAAAGCTCAGGTAGAGGG + Intergenic
1039699922 8:39951658-39951680 CTGGCTCAAGGTCAGAAGACTGG - Intronic
1040808695 8:51425101-51425123 CTGGCAATAGGTGAGGAGAAGGG - Intronic
1041192996 8:55372335-55372357 CTGGCTAAAGGTCAGGTGAATGG - Intronic
1042096094 8:65217538-65217560 CTGCCTGAAGGTCAGGAGATAGG + Intergenic
1044334036 8:90955379-90955401 CAGACTAAAGGTAAGGGGAATGG + Intronic
1044368469 8:91378544-91378566 CTTGCTAAAGGTCTGGGAAAAGG + Intronic
1044979453 8:97700984-97701006 CTGGCTAAAGGTTAGGGGGCTGG + Intronic
1045064155 8:98430738-98430760 CTGGGTAGAGGCCAGGAGAAAGG + Exonic
1047324259 8:123821226-123821248 CAGGCCAAAGGTGAGGTGGAGGG - Intergenic
1048358599 8:133674879-133674901 CTGGGTAAATGTCAGGGAAAGGG + Intergenic
1049534025 8:143169752-143169774 CTGGCTCATGGTCAGGTGGCAGG - Intergenic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050991114 9:12153469-12153491 CTGACTAAAGGGCACTTGAAAGG - Intergenic
1056888220 9:90464449-90464471 CTGGCTAAAGCTAATGTTAAAGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1057092202 9:92268575-92268597 CTGGCTAAAGCTAAGGTGACTGG - Intronic
1057973282 9:99577680-99577702 ATGGCTCAAGGACAGGAGAATGG + Intergenic
1060561141 9:124544697-124544719 CTGGCTAAAGCATAGGGGAAGGG + Intronic
1187432747 X:19239826-19239848 CTGGCTATAGCACAGGTGAGAGG + Intergenic
1189740296 X:44110875-44110897 CTGGCTAGAGGCCTGGAGAAAGG - Intergenic
1191658744 X:63629376-63629398 CTGCCTGAAGGACAGGTGAAGGG - Intergenic
1194879379 X:99231899-99231921 CTGACTAAAGGTCATTTCAATGG + Intergenic
1195543635 X:106090153-106090175 CTGGTCAAAGATCAGGTGGATGG - Intergenic
1195857917 X:109350529-109350551 CTGACTAAAAGTCAGGCAAAAGG + Intergenic
1198591035 X:138182209-138182231 CTGACTAAAGGTCAACTGATTGG + Intergenic