ID: 1041193601

View in Genome Browser
Species Human (GRCh38)
Location 8:55377829-55377851
Sequence TTTCCAGAAGTGCCTTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041193601_1041193605 24 Left 1041193601 8:55377829-55377851 CCCCAGAAAGGCACTTCTGGAAA 0: 1
1: 0
2: 1
3: 20
4: 250
Right 1041193605 8:55377876-55377898 TGTTTAATTTAGTGAGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041193601 Original CRISPR TTTCCAGAAGTGCCTTTCTG GGG (reversed) Intronic
902909874 1:19587784-19587806 TTACCAGGTGGGCCTTTCTGTGG - Intergenic
905208038 1:36354150-36354172 TTCCCAGAGCTCCCTTTCTGTGG + Intronic
905521377 1:38603142-38603164 TCTCCAGAAGTGCAGTTCAGGGG - Intergenic
907899796 1:58727793-58727815 TTTCCAGTAGTGCCACTCAGGGG + Intergenic
908066076 1:60406338-60406360 TTTAGAAAAATGCCTTTCTGAGG + Intergenic
910003492 1:82365804-82365826 TTTCCAGAAGGACCTGACTGAGG + Intergenic
910283171 1:85524083-85524105 TTCCCAGCAGTGACTTGCTGGGG - Intronic
911273509 1:95832111-95832133 CTTCCTGATGTCCCTTTCTGTGG - Intergenic
912520759 1:110243199-110243221 TTTCCAGAAATTCCTTGCTAGGG + Intronic
912734263 1:112136025-112136047 TTGCCAGAAGTCCCTTCCTAGGG - Intergenic
914206843 1:145538906-145538928 TTCCCAGCAGTGACTTGCTGGGG + Intergenic
914724271 1:150314351-150314373 GATCCAGAAGTGCATTTCAGGGG - Intergenic
917748092 1:178029971-178029993 TCTTCAGAAGTATCTTTCTGAGG - Intergenic
918244470 1:182646711-182646733 TTTCCAGGAGTTCCCTTCTGAGG + Exonic
918852212 1:189707148-189707170 TTTCCATCAGTACCTTTCTCTGG - Intergenic
919047759 1:192475154-192475176 TTCGCAGATGTGCTTTTCTGAGG - Intergenic
920035159 1:203060684-203060706 TTTCCAGGATGGGCTTTCTGGGG + Intronic
920364779 1:205442351-205442373 TTTGCACATGTGCCTTGCTGGGG - Intronic
921057234 1:211552201-211552223 TTTCCAGAAGCCCCATTCAGTGG - Intergenic
921303461 1:213772495-213772517 TTTGCTGAACTGCCTTTCTAGGG + Intergenic
922129178 1:222759677-222759699 TTTCCAGAAGTAGCAGTCTGAGG + Intergenic
1063097222 10:2918674-2918696 CTTCCAGAAGTTCCCTGCTGGGG + Intergenic
1063648489 10:7909407-7909429 TTGGCAGAAGTGCTGTTCTGAGG - Intronic
1064541678 10:16412254-16412276 TGTCCAGAAGTGTTTTCCTGGGG + Intergenic
1065289522 10:24215751-24215773 TGTGCTGAAGTGCCTTTGTGTGG + Intronic
1065411830 10:25437802-25437824 TTTCCAGAAGTGTGTCTCTGAGG + Intronic
1065618785 10:27557338-27557360 TTTGTAGAAGTGCCATTGTGTGG - Intergenic
1066571620 10:36779485-36779507 TTTCCAGTTGTGCTCTTCTGGGG - Intergenic
1070986622 10:80695178-80695200 CTTTCAGAGGTGCCTTCCTGTGG + Intergenic
1071923659 10:90380029-90380051 TTTCCCAAAGTGGCTTTCTCTGG - Intergenic
1072647039 10:97264559-97264581 TTTCCAGAAGTGTCTCTCTGAGG + Intronic
1072800805 10:98391067-98391089 CTTCCAGGAGTGGCTTCCTGAGG - Exonic
1074307738 10:112294642-112294664 CTTCCAGCATTGCCTTTCTAGGG - Intronic
1075470372 10:122684388-122684410 TTTCCAGAAGGGTCTTTGGGAGG - Intergenic
1075745884 10:124727272-124727294 TATCTACAAGTGCCTTCCTGAGG - Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1076939630 10:133593558-133593580 TTTCCAGATGTTTCTCTCTGTGG + Intergenic
1079146930 11:17861099-17861121 TTTCCAGTAATGCATGTCTGTGG + Intronic
1079931897 11:26573703-26573725 TTTCCTGAAGACCCTTTCTGTGG + Intronic
1079975330 11:27083932-27083954 TTTCCAGAAGGGCATTGCAGAGG + Intronic
1081023450 11:37976871-37976893 TATCCAAAAGTGCCTTCTTGAGG - Intergenic
1081638105 11:44734308-44734330 TTTCCAGGTCTGCTTTTCTGTGG + Intronic
1081749650 11:45500795-45500817 TTTCCAGGAGTGCCAACCTGTGG - Intergenic
1082126806 11:48441946-48441968 TGTCCAGAAGAGCTTTTCTTAGG + Intergenic
1082250214 11:49970378-49970400 TGTCCAGAAGAGCTTTTCTTAGG - Intergenic
1082560381 11:54612908-54612930 TGTCCAGAAGAGCTTTTCTTAGG + Intergenic
1083087719 11:60167949-60167971 TTTCCAGAATTGCTGCTCTGGGG + Intergenic
1083649499 11:64193328-64193350 CTTCCAGAAATGCCTTTTGGTGG + Intronic
1085418567 11:76336384-76336406 TTTCCTGAAGTGCATTCCTCAGG + Intergenic
1086457778 11:86976309-86976331 TCCCCAGAAGAGCCTTTCTAAGG + Intergenic
1086947380 11:92856511-92856533 TTTCCAGGATTTCCCTTCTGAGG + Intronic
1087664688 11:101030697-101030719 TCTCCAGACTTGCCTTTCTGTGG - Exonic
1088002243 11:104896283-104896305 TTTCCAGACATTTCTTTCTGGGG + Intergenic
1088465126 11:110126990-110127012 TTTCCAGAAGTTACTTTGGGTGG + Intronic
1088496839 11:110439759-110439781 TTTCCAGGAGAGCATTTCTGAGG + Intronic
1089662979 11:119997694-119997716 TATGCAGTAGTGCCTATCTGGGG + Intergenic
1090070119 11:123536704-123536726 TTTCTAGTAGTGCCTTTCTCAGG + Intronic
1090333323 11:125947538-125947560 ACTCCAGAAGTGCTTTTATGTGG + Intergenic
1090915739 11:131160570-131160592 TTCCCCTAAGTGCCTGTCTGCGG - Intergenic
1091292584 11:134450088-134450110 TTTCCAGAAATGCATTGTTGAGG - Intergenic
1093056275 12:14558812-14558834 TTTGCAGAAGTTTCTTTTTGTGG - Intronic
1094287849 12:28815108-28815130 TTTCCAGAATTGCTGTTCTGGGG - Intergenic
1096230986 12:49896839-49896861 TGGCCAGAAGCACCTTTCTGGGG - Intronic
1096499453 12:52056122-52056144 CTTCCAGAAGTGCCTGGCGGTGG + Exonic
1096626684 12:52900122-52900144 TTTCCACAACAGCCTTTCTTAGG + Intronic
1097044779 12:56179528-56179550 ATTCCAGAAGTGTATTTCAGGGG - Intronic
1097720804 12:63018812-63018834 TGCCCAGAGGTCCCTTTCTGGGG - Intergenic
1098128677 12:67325425-67325447 TTTCCAGAAGAGTCTTTTTAAGG + Intergenic
1099374510 12:81882503-81882525 TTCCCAGAAGTGTTTTTTTGTGG + Intergenic
1101225066 12:102680133-102680155 TTTCCCAAAGTACCTTTTTGGGG + Intergenic
1102657114 12:114491355-114491377 CTTCCAGAAGTGGGTTTGTGTGG + Intergenic
1103431276 12:120889176-120889198 TTCATAGAAGTCCCTTTCTGTGG - Intronic
1105880456 13:24601211-24601233 TGTCAAGAAGGGCATTTCTGAGG + Intergenic
1106230530 13:27817755-27817777 TTTCCAGCATTGCTTTTCTCAGG + Intergenic
1109031552 13:57196479-57196501 TTTCTTGATGTCCCTTTCTGTGG + Intergenic
1109716117 13:66224860-66224882 AATCCAGAAATGTCTTTCTGAGG - Intergenic
1109916642 13:68996083-68996105 TTTTCAGTAGTGCCTTACTCAGG + Intergenic
1110358427 13:74595933-74595955 TCTCCAGAAGTGTATTCCTGAGG + Intergenic
1111381042 13:87452375-87452397 TTTCCAGGACTCCCTTTCTGTGG - Intergenic
1112920923 13:104611985-104612007 TTTCAACAAGTGCTTTTATGAGG - Intergenic
1114358166 14:21938193-21938215 TATCCAGAAGTGCGTTTCCTAGG + Intergenic
1114799783 14:25760591-25760613 TTTTCAGAATTGCTTTTCTAAGG - Intergenic
1115477981 14:33834649-33834671 TTCCCAGGAATGCCTTCCTGTGG + Intergenic
1116099400 14:40413475-40413497 TTTCCAGAAGTGAAGTTCTTAGG - Intergenic
1116266676 14:42700535-42700557 TTTCCAGAGGTCTCTTTCTTTGG + Intergenic
1117694933 14:58351344-58351366 TCTCCAGAAGCACCTGTCTGGGG + Intronic
1117857964 14:60055439-60055461 TTTCAAGAAGTGACTTGCTTCGG - Intronic
1120356185 14:83436864-83436886 TTTTCAAATGTGTCTTTCTGTGG - Intergenic
1121045791 14:90786432-90786454 GTTCCAGAAGGACCTTGCTGGGG - Intronic
1122904036 14:104793843-104793865 CTTCCAGATGGGCCTTCCTGAGG + Exonic
1123030100 14:105447546-105447568 TTTCCAGAAGGGCCTCGTTGGGG + Intronic
1125701719 15:41692281-41692303 TTTCCAGGCCAGCCTTTCTGCGG + Intronic
1128209169 15:65881471-65881493 TTTTCAGATGAGACTTTCTGAGG - Intronic
1128223766 15:65987357-65987379 TTTCCACAAGTGCCTTATTCAGG + Intronic
1128411232 15:67400417-67400439 CTGCCAGCAGTGCCTTTCTTGGG + Intronic
1130718762 15:86365105-86365127 TCTCCAGAACTGCCCTGCTGAGG + Intronic
1131132553 15:89909615-89909637 TTTCCAGAAATACATCTCTGAGG - Intronic
1131350311 15:91693442-91693464 TTTCTAAAAGTTCATTTCTGAGG + Intergenic
1131977732 15:97961932-97961954 TTTCCAGAAGTACCCATGTGGGG + Intronic
1132609726 16:809390-809412 TTTCCAGAGGAGCCTGCCTGGGG - Intronic
1133181212 16:4056019-4056041 TTTCCAGCACTGCCTGTCTATGG - Intronic
1133657944 16:7884892-7884914 TTTCCTGAAGTGCTTCCCTGAGG + Intergenic
1135634367 16:24061456-24061478 TATCTGGAAGTGCCTTCCTGTGG + Intronic
1137341109 16:47606689-47606711 TTTGCAGAATTGCATTTCAGGGG + Intronic
1138143066 16:54585103-54585125 TTTCCAGAGGTGCCTTCGGGAGG + Intergenic
1138356178 16:56382712-56382734 TTTTCAGATGTGCATTTCAGTGG - Intronic
1138894010 16:61180938-61180960 TTTCAAGAAGTGATTTCCTGGGG - Intergenic
1140876069 16:79153512-79153534 TTTCCACAAGTGCATTGCCGTGG - Intronic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG + Intergenic
1144351856 17:14404109-14404131 TTTCCTAAAGTGACTTTCTTTGG + Intergenic
1144599570 17:16600329-16600351 TTTCCCAAAGTGCCTGACTGTGG + Intergenic
1146780455 17:35666592-35666614 TTCCCAGGATTGCCTTACTGAGG - Intronic
1147388688 17:40096458-40096480 CTTCAAGAAGTGTCTCTCTGTGG - Exonic
1147603393 17:41759603-41759625 TTTCCAGAGCTGCCCTGCTGGGG - Intronic
1150886936 17:69098090-69098112 TTTCAAAAAGTGCATTTTTGTGG - Intronic
1154395757 18:13987177-13987199 TTTCCAGTTGTTCCTTTATGGGG + Intergenic
1155251841 18:23960380-23960402 TTTCCTGATTTGCCATTCTGAGG + Intergenic
1155772106 18:29714457-29714479 CTTCCAGAAGTGCTATTGTGGGG + Intergenic
1157127935 18:44974975-44974997 TTTCAAAAAGTGCCTTTGTGAGG - Intronic
1159999236 18:75001004-75001026 TTTCCAGAATTCTCTTTTTGAGG + Intronic
1160090405 18:75821443-75821465 CATCCAGATGTGCCTTTCTTTGG - Intergenic
1161513559 19:4684542-4684564 CAGCCAGAAGTGCCCTTCTGCGG + Intronic
1168521194 19:57051831-57051853 ATTACAGAAGTGCTTTCCTGTGG - Intergenic
925595203 2:5548854-5548876 TTTACAGAAGTGCTTATGTGGGG + Intergenic
926462729 2:13152983-13153005 GATCCAGAAGTGTCTTTCTTAGG + Intergenic
928500596 2:31890459-31890481 TTAAAAGGAGTGCCTTTCTGTGG - Intronic
930043206 2:47145296-47145318 TTTCAGGAAGTACCTTTCTAGGG - Intronic
930284225 2:49408054-49408076 TTTCATGATGTGCCTTTTTGTGG + Intergenic
933483821 2:82893141-82893163 TTTCCAAAAGTGATTGTCTGTGG - Intergenic
934144220 2:89075658-89075680 ATTCAAGAAGTGAGTTTCTGTGG - Intergenic
937633850 2:124133636-124133658 TATCCAGCACTGACTTTCTGTGG + Intronic
938210287 2:129461041-129461063 TTTCCATTAGGGCCTTGCTGTGG - Intergenic
940116626 2:150216251-150216273 CTTCCAGAAATGTTTTTCTGAGG - Intergenic
941260861 2:163295299-163295321 TTTGTAGAAGTTCCTTTCTCTGG - Intergenic
942631468 2:177954661-177954683 ATTCCAGAATGGCCTTACTGGGG - Intronic
943485152 2:188470022-188470044 TTTTCAGATGTGCCTTTATCTGG + Intronic
944929121 2:204498366-204498388 TTTGAAGAAGTGGCTTTCTTTGG - Intergenic
945576641 2:211538712-211538734 TTTTTATGAGTGCCTTTCTGTGG - Intronic
946941627 2:224775355-224775377 CTTCCAGATGTGCCTGGCTGTGG + Intronic
948447352 2:238043159-238043181 TTTTCAGAAGAGCGCTTCTGTGG + Intronic
948779823 2:240312052-240312074 TTTCCAAATGTCCCTTTCTCTGG - Intergenic
948965268 2:241374711-241374733 TTTTCTGAAGTGCTTATCTGAGG + Intronic
1168970228 20:1926019-1926041 TGTCCCGAGCTGCCTTTCTGTGG + Intronic
1169335491 20:4752558-4752580 TTTAGAGAAGTGCCTTGGTGGGG - Intergenic
1169953133 20:11070407-11070429 TTCCCAGAAGTGGATTTCTTGGG - Intergenic
1171204645 20:23269352-23269374 TTTCCACAACTGCCTTGCGGTGG - Intergenic
1172829681 20:37822886-37822908 TTTCCAGACAGGTCTTTCTGAGG - Intronic
1173194538 20:40903452-40903474 GTTCCAGGAGGGCCTCTCTGTGG + Intergenic
1173807078 20:45933178-45933200 TTTTCAGAAGTGCCCTGCTTTGG - Intergenic
1174574793 20:51529229-51529251 TTTTCAGGACTGCGTTTCTGTGG - Intronic
1178891709 21:36525575-36525597 TTTCCAAAAGTTCCTTTGTCTGG - Intronic
1180111939 21:45662469-45662491 TGTCCAGAAGAGTTTTTCTGTGG + Intronic
1183788129 22:40043751-40043773 TTTCTAGAAGTGACTTTGTTGGG - Intergenic
950578014 3:13844699-13844721 TTTAAAGAAGTGCCTTTGTCAGG + Intronic
951319933 3:21232257-21232279 TTTCCTGAAGTTACTTCCTGTGG - Intergenic
951472768 3:23073724-23073746 TTTTCACTTGTGCCTTTCTGGGG - Intergenic
952821201 3:37487374-37487396 TCTCCAGCAGGGCCTCTCTGGGG + Intronic
953702924 3:45210609-45210631 CCTTCAGAAGTGTCTTTCTGAGG - Intergenic
954895655 3:53972840-53972862 GTTCCAGAAAGGCCTCTCTGAGG - Intergenic
954904163 3:54045535-54045557 TTTTCAGATGTACTTTTCTGGGG + Intergenic
956870063 3:73408030-73408052 TTGTCAGAAATGCGTTTCTGTGG - Intronic
959397205 3:105855414-105855436 CTTCCATAATTACCTTTCTGTGG - Intronic
960680864 3:120246281-120246303 TTCCCAGAGGTGCACTTCTGTGG + Intronic
961556420 3:127699211-127699233 TTTCCAGCACTGTCTCTCTGTGG + Intronic
962591334 3:136892272-136892294 TTTCCAAATATTCCTTTCTGTGG + Intronic
963179290 3:142337222-142337244 TTACAAGAAAGGCCTTTCTGAGG - Intronic
964738001 3:159935820-159935842 TGTCCAGAAGAGACATTCTGTGG + Intergenic
965787136 3:172347404-172347426 TTTCCCAAAGTGCCTTTCATGGG - Intronic
966081568 3:176010359-176010381 TATCCAGAATTCCCTTTCTTTGG + Intergenic
967595827 3:191326080-191326102 TTTCCAGAAGTATAGTTCTGTGG + Intronic
969566515 4:7981976-7981998 TTTCCAGACTTCCCCTTCTGAGG + Intronic
971383682 4:26123889-26123911 CTTCCAGAAGTACCTTCCTGAGG + Intergenic
975302374 4:72805371-72805393 TTTTCAGATGTGCCTTGGTGTGG - Intergenic
975940260 4:79635278-79635300 AGTCGAGAAGTGTCTTTCTGAGG + Intergenic
975987084 4:80210654-80210676 TTTGGAGAAGAGCCTTACTGTGG + Intergenic
976639379 4:87321426-87321448 TTTCCAGATGTGTATTTTTGGGG - Intronic
977538375 4:98283313-98283335 GTTGCAGAAATGCATTTCTGGGG + Intronic
978083594 4:104622960-104622982 TTTCCATGAATGCCTTTCTGTGG - Intergenic
978117968 4:105044691-105044713 TTTCCACCTCTGCCTTTCTGGGG + Intergenic
978155115 4:105480942-105480964 TTTCCAAAAATGCCTCTTTGGGG - Intergenic
979118151 4:116854407-116854429 TGTCCAGAAGTGTTTTCCTGAGG + Intergenic
980668156 4:135967234-135967256 TTTTCAGAAGTTCTTTTCAGTGG + Intergenic
981326752 4:143456900-143456922 TTTTCAGCAGTGCTTTTATGTGG + Intronic
981598806 4:146460604-146460626 TTTCCAGAATAGCCTATCAGTGG - Intronic
981964108 4:150580316-150580338 TTGCCATAAGTCCCTTTCTAAGG - Intronic
982273661 4:153617621-153617643 TTTCCAGAACTTCTTTTCAGTGG - Intronic
986013637 5:3739100-3739122 TTTCTTGAACTGCCTGTCTGTGG + Intergenic
986025055 5:3842882-3842904 TTTCCAAAAGTGCATGGCTGGGG + Intergenic
986916622 5:12627059-12627081 TTTCCAGAGGTTCCTAACTGAGG - Intergenic
987169238 5:15236678-15236700 TTTTTAAAAATGCCTTTCTGGGG - Intergenic
987478574 5:18423925-18423947 CTTCCAGAAGTACCATCCTGAGG + Intergenic
989110501 5:37902410-37902432 TTTGCAGAACAGACTTTCTGGGG - Intergenic
989532000 5:42518556-42518578 ATTCCAAAACTGCCTCTCTGAGG - Intronic
993668345 5:90728840-90728862 TTTCAAGAGGTGCCTGTCAGTGG + Exonic
996797902 5:127370304-127370326 TTACCACAACTGCCTTACTGAGG - Intronic
997640095 5:135443351-135443373 TTTCCATAATTGCTTCTCTGAGG - Intergenic
998397728 5:141829854-141829876 TTTCCAGATGGGCCAGTCTGAGG - Intergenic
999717613 5:154374141-154374163 TTTCCAAAAGAGACTTTCTTGGG - Intronic
999950133 5:156640135-156640157 TTTCCAATAGTGCTCTTCTGAGG + Intronic
1000149726 5:158487776-158487798 TTTACAGAAGTTCCTCTCTCTGG - Intergenic
1000823551 5:166015284-166015306 TTTGCAGAAGAGACTTTCTGTGG + Intergenic
1002396710 5:178962310-178962332 TTTTCAGTAGTGCCTAGCTGAGG + Intronic
1003027164 6:2565213-2565235 TTTCCACAACTGGCTTTCTGGGG + Intergenic
1005804169 6:29458500-29458522 AGTCCAGAAGTTCCTTTCTATGG + Exonic
1006870157 6:37243941-37243963 TTTTCAGACTTGCATTTCTGAGG - Intronic
1009401403 6:63260285-63260307 TTGCCAGAATTGCCTTTATATGG - Intergenic
1009710060 6:67306841-67306863 TGTCCAGAAGAGACTTTCTTAGG + Intergenic
1009961367 6:70526277-70526299 TTTTCAGAAGTTTCCTTCTGAGG - Exonic
1012828810 6:104180847-104180869 ATTACAGAAGTGGGTTTCTGTGG - Intergenic
1014562796 6:122911618-122911640 TTTCCTGTAGTGCCTTTATCTGG + Intergenic
1015404716 6:132824081-132824103 TTTCCAGAATAGGCTTTCTCTGG - Intergenic
1017336100 6:153262115-153262137 TTAACAGAAGGGCCTTTCTTAGG + Intergenic
1018580875 6:165307719-165307741 TTTCCAGAAGTACATTTCTTAGG - Intronic
1019022835 6:168932784-168932806 GTTGGAGAAGTGCATTTCTGTGG - Intergenic
1019849831 7:3543558-3543580 TTTCCAGACCTGCCTTTATGTGG - Intronic
1021796852 7:24264113-24264135 AGTCTAGAAGTGCCTTTCAGTGG + Intergenic
1023019093 7:35994373-35994395 TTTCCATCAGTGCCTTTCCTGGG + Intergenic
1026903852 7:74051606-74051628 TCTCCAGATGGGCCTGTCTGGGG - Intronic
1027442128 7:78230832-78230854 TTTCCTGATGTGCCTTCCTCAGG + Intronic
1027936634 7:84612832-84612854 TTTCCAGAAATGTATTTCTTGGG - Intergenic
1028263361 7:88691454-88691476 TTTCCAGAAATGTCTTGCGGTGG - Intergenic
1028394664 7:90354787-90354809 TTTACTGAAGTGTTTTTCTGGGG + Intronic
1029974717 7:104822180-104822202 GTTCCAGAAGTGACTTTCGTTGG + Intronic
1033603491 7:142907944-142907966 TTTTCAGATGTGCCATTCAGTGG - Intergenic
1033655855 7:143373757-143373779 TTTCCATAAGTGACATTCTGGGG + Intergenic
1034721459 7:153297791-153297813 TTTTCAGAAGTGCATTTCAGAGG + Intergenic
1034749184 7:153552811-153552833 TTGCCAGAAGTCACTTACTGTGG + Intergenic
1034953671 7:155318677-155318699 TCTCCTGATGCGCCTTTCTGTGG - Intergenic
1036145965 8:6255050-6255072 TTTCCAGGCGTGACTTCCTGGGG + Intergenic
1041193601 8:55377829-55377851 TTTCCAGAAGTGCCTTTCTGGGG - Intronic
1041505884 8:58596984-58597006 CTTCCAGAAGGGACTTTCTCTGG - Intronic
1042325996 8:67528462-67528484 GTCCCAGAAATGGCTTTCTGCGG + Intronic
1042712203 8:71730644-71730666 CTTCCATAAGTGCCTATCAGTGG + Intergenic
1042742681 8:72068250-72068272 GTTCCAGAAGTTCATTTCTAAGG - Intronic
1042758437 8:72244074-72244096 GTTCCAGAAGTTCATTTCTAAGG - Intergenic
1043692950 8:83180306-83180328 TTGCCAGCAGTCCCTTTATGAGG + Intergenic
1044068501 8:87726245-87726267 ATTGCAGAAATGGCTTTCTGGGG - Intergenic
1047011132 8:120673663-120673685 TTCCCAGAAGTGCCTGTTTCAGG + Intronic
1048561048 8:135537970-135537992 TTGCCAATAGTCCCTTTCTGTGG - Intronic
1050014515 9:1219703-1219725 TTTCTACTAGTGCCTTTCTTTGG + Intergenic
1050078506 9:1890140-1890162 TTTTCAGAGGTGCCTTTGTGAGG - Intergenic
1050275388 9:3992248-3992270 TTTCCAGAAGTAATTTTTTGGGG + Intronic
1050690333 9:8220493-8220515 TTTCAGGAAAGGCCTTTCTGAGG + Intergenic
1050763838 9:9108217-9108239 ATTCAAGAAATGCCATTCTGGGG - Intronic
1050881354 9:10704099-10704121 TGTCCAGAATTGTCTTTCTTAGG + Intergenic
1056194506 9:84216179-84216201 GTTCTAGAAGTGTCTTTGTGAGG + Intergenic
1056508816 9:87283280-87283302 TTTCAGGAAATGCCTTCCTGAGG - Intergenic
1056713374 9:89009427-89009449 TGTCCATAAATCCCTTTCTGTGG - Intergenic
1059846997 9:118291123-118291145 ATTTCAGAAGTGCCTTAATGTGG + Intergenic
1061476657 9:130872075-130872097 TTTCAGGAAGTGCTTTTCAGTGG - Intronic
1062202099 9:135308927-135308949 GTTCCAGAACTGCCTCTCTTAGG + Intergenic
1185855018 X:3525786-3525808 TTTCCAGACTTACCCTTCTGTGG - Intergenic
1186054092 X:5630358-5630380 TGACCAGAAGTGCTTTCCTGAGG + Intergenic
1186525130 X:10241451-10241473 TTCCTAGAAATGTCTTTCTGGGG - Intergenic
1187254850 X:17633368-17633390 TTTCCAGAAGTTTTCTTCTGTGG - Intronic
1187799345 X:23042997-23043019 TTTCCACAACTGTCTTTCTTTGG - Intergenic
1189969708 X:46405758-46405780 TTTCCAGGAGTGCCTTTTAAAGG - Intergenic
1190359317 X:49634373-49634395 TTTCCACAAGTGAATTTCGGTGG + Intergenic
1193664787 X:84301976-84301998 TTGCCAGATATGCCATTCTGAGG - Intergenic
1194267405 X:91771859-91771881 TTTCCACCAGTCCCTTTCTGTGG - Intergenic
1194765506 X:97843198-97843220 TTTCCTTAACTGCCTTACTGAGG + Intergenic
1194894895 X:99428637-99428659 TTTCCATAAGTGCTATACTGGGG + Intergenic
1195511642 X:105722636-105722658 TTTCTAGAAATGCCTTTGAGAGG - Intronic
1195612879 X:106889254-106889276 TATCCAGAAGTGCAAATCTGTGG - Intronic
1195756280 X:108202150-108202172 GGTCAAGAAGGGCCTTTCTGAGG - Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198840097 X:140847207-140847229 GTTCCACATGTGCCATTCTGGGG + Intergenic
1199659566 X:150035380-150035402 TTCCCAGTAGTACCTTTCTCAGG + Intergenic
1200584611 Y:4992796-4992818 TTTCCACCAGTCCCTTTCTGTGG - Intergenic
1200913100 Y:8548306-8548328 TGTCCAGTAGTGCTTTTGTGGGG - Intergenic
1200936445 Y:8742510-8742532 TGTCCAGTAGTGCTTTTCAGGGG + Intergenic