ID: 1041195977

View in Genome Browser
Species Human (GRCh38)
Location 8:55401668-55401690
Sequence CTTTGGCCCCAGATGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041195977_1041195982 -2 Left 1041195977 8:55401668-55401690 CCTGGGTCCATCTGGGGCCAAAG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1041195982 8:55401689-55401711 AGGCCAGGTCCTTTCCATTAAGG No data
1041195977_1041195987 27 Left 1041195977 8:55401668-55401690 CCTGGGTCCATCTGGGGCCAAAG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 1041195987 8:55401718-55401740 TTCACAAGTGTTTTGTGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041195977 Original CRISPR CTTTGGCCCCAGATGGACCC AGG (reversed) Intronic
900250326 1:1665451-1665473 CTCTGGCTCCCGGTGGACCCTGG + Exonic
900457868 1:2786126-2786148 CGTTGGCACCAGGTGGACCCTGG - Intronic
900987644 1:6082505-6082527 CTTTGGCACCAGAGGGACTGTGG - Intronic
901458464 1:9377294-9377316 CTTTGGCCCCAAAGGGAGGCAGG - Intergenic
903605979 1:24575536-24575558 GTTTGGGCTCAGATGGACCTAGG - Intronic
905024983 1:34843795-34843817 CTCTGGCTCCAGCTGGACTCAGG + Intronic
906229914 1:44153306-44153328 CTTTTACACCACATGGACCCAGG + Intergenic
907411658 1:54287645-54287667 ACCTGGCCCCAGAGGGACCCGGG - Intronic
907613958 1:55905016-55905038 TTTTAGCCCCAAATGGACACAGG + Intergenic
909703559 1:78553743-78553765 CATTGGCCCAAGATGGACTTAGG - Intergenic
910984330 1:92990988-92991010 CATTGGTCCCAGATGGTCCCTGG - Intergenic
911097865 1:94069999-94070021 CTTTGGACCCAGTTAGACGCAGG - Intronic
913491426 1:119383411-119383433 CTTTGGCCCCTGATGGGCCAGGG + Intronic
916812780 1:168319963-168319985 ACTAGGCCCCAGATGGTCCCTGG - Intergenic
917438083 1:175041207-175041229 CTCTGGCGCCACATGGACCATGG - Intergenic
917648781 1:177055401-177055423 CATGGTCCCCAAATGGACCCTGG + Intronic
919788305 1:201274357-201274379 CTTTTGCCCAAGAAAGACCCTGG - Intergenic
919848421 1:201656033-201656055 CTTTGGCTCCAGCAGGCCCCAGG + Intronic
919919710 1:202160739-202160761 CTTGGGCCCCAGAAGGGCACAGG - Exonic
922800912 1:228364410-228364432 CCTTGGCCCTAGGTGGCCCCAGG - Intronic
924813706 1:247424855-247424877 CTTTGGCTGCAGATGGAATCTGG + Exonic
924944648 1:248838238-248838260 CTCCGGCCCCAGCTGGAGCCGGG - Intronic
1063862718 10:10329030-10329052 CTTAAGCCCCAAATGGTCCCTGG - Intergenic
1069955094 10:72045006-72045028 CTGTGGCCCCAGGCGGATCCCGG - Intergenic
1070793536 10:79203686-79203708 CCTCTGCCCAAGATGGACCCAGG - Intronic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1071010032 10:80927636-80927658 CTTTAGCCCCAGATAGCACCGGG - Intergenic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1072720773 10:97779778-97779800 CTTTGGAGCCAGATGGGCTCAGG + Intergenic
1074289356 10:112126863-112126885 CTCTGTGCCCAGATGGACTCGGG - Intergenic
1076371517 10:129959053-129959075 CTTTGGCGCCAAATCGCCCCGGG + Intronic
1076570940 10:131432488-131432510 CCTTGGCCCCTGCTGGACACTGG - Intergenic
1076977809 11:188682-188704 CTATGGACCCAGATGGTCCTGGG - Intronic
1077258867 11:1604783-1604805 CTGTAGCCCCAGATGGCTCCTGG - Intergenic
1078526543 11:12105775-12105797 CTTTAGCCCCAGATAGACTGGGG - Intronic
1080006741 11:27416257-27416279 CTTTGGCGCCAGACAGACCAAGG + Intronic
1081526528 11:43931519-43931541 CTTTGGCAGCAGATTGACCTGGG + Intronic
1083207345 11:61160796-61160818 CTTTGCGCCCAGAGGGTCCCGGG + Intronic
1083970094 11:66069703-66069725 GGTTGGCTCCAGATGGGCCCCGG + Intergenic
1085972751 11:81612568-81612590 TTTTGGGGCCAGATGGACCTGGG - Intergenic
1086372109 11:86165181-86165203 CTTTAGCCCCAGATGGGCAGTGG + Intergenic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1088914918 11:114220179-114220201 CTCTGGGCCCAGATGGTCCTTGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089750660 11:120648976-120648998 CCTTGGCCCCCGAGGGAGCCTGG + Intronic
1092783780 12:12010045-12010067 CTTTGGCCATAGATGGACCTCGG + Intergenic
1094230811 12:28100972-28100994 CTTTGGCCCCAGACAGAACCAGG + Intergenic
1094813384 12:34162965-34162987 CCTGTGCCCCAGATGGAACCAGG + Intergenic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1105019794 12:132808403-132808425 CTTAGGCCCCCGAGGGACACTGG + Exonic
1105704546 13:22961002-22961024 CTTTGTCCGCAGATGGGCCCAGG + Intergenic
1107834757 13:44404404-44404426 CATTTGCCCCAGATGCTCCCTGG - Intergenic
1108694226 13:52888651-52888673 CTGTGGCCCCAGAATGACCAGGG - Intergenic
1110869827 13:80437841-80437863 CTATGGTTCCAGATGGCCCCAGG - Intergenic
1111364432 13:87223578-87223600 TTTTGGCTCAAGATTGACCCCGG + Intergenic
1114728624 14:24966421-24966443 CTTTGGAGTCAGATGGACCCAGG + Intronic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1116669370 14:47821501-47821523 CTCAGGCCCCAGGTGGATCCAGG + Intergenic
1117826278 14:59707111-59707133 CTTTGGAGCTAGATGGACCTTGG - Intronic
1119312310 14:73658861-73658883 CTTTGGCTTCAGATGGCCTCTGG - Exonic
1121466554 14:94119210-94119232 TCCTGGCCCCAGATGGCCCCTGG + Intergenic
1121607359 14:95251020-95251042 GTTTGGCTCCAGGTGGTCCCTGG - Intronic
1121865514 14:97359131-97359153 CTTTGTACCCAGAAGGACCTGGG - Intergenic
1122987079 14:105217441-105217463 CTGTGGCCCCGGCTGGCCCCCGG + Intronic
1123032277 14:105457539-105457561 CTGTGCCCCCAGAAGGTCCCTGG + Intronic
1126953685 15:53910929-53910951 CTTTGGCCCCTGAGGGCTCCTGG + Intergenic
1132104893 15:99056338-99056360 CTTCGGAGCCAGATGGATCCTGG + Intergenic
1132603689 16:784872-784894 CTGAGGCCCCAGCAGGACCCAGG - Intergenic
1133015250 16:2936747-2936769 CTTTGTCCCCAGAGGGCCCCGGG + Intronic
1133220687 16:4317970-4317992 CTTCGGCCCCTGAGTGACCCTGG + Intronic
1134827548 16:17296640-17296662 ATTTGTCCCCAGTTGGCCCCGGG - Intronic
1136254732 16:29030353-29030375 CTTTGCCCCCAGAGTGGCCCTGG - Intergenic
1136274371 16:29169793-29169815 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1136930105 16:34410854-34410876 CTTTGGCATCATATAGACCCAGG - Intergenic
1136974469 16:35000951-35000973 CTTTGGCATCATATAGACCCAGG + Intergenic
1139236926 16:65349490-65349512 CTTCAGCCCCAGATGGACGTGGG + Intergenic
1140947548 16:79784061-79784083 CTTTGGACCCAGAGGGACCAGGG - Intergenic
1141630203 16:85283515-85283537 CGAAGGCCCCAGAGGGACCCAGG + Intergenic
1142078652 16:88135439-88135461 CTGTTGGCCCAGATCGACCCTGG - Intergenic
1142442523 16:90108647-90108669 CTATGGACCCAGATGGTCCTGGG + Intergenic
1142465230 17:133147-133169 CTATGGACCCAGATGGTCCTGGG - Intergenic
1142566495 17:843621-843643 CTTTGACTCCAGATCGACGCTGG - Intronic
1145303254 17:21654994-21655016 CTCAGGCTCCAGGTGGACCCAGG - Intergenic
1145346784 17:22046848-22046870 CTCAGGCTCCAGGTGGACCCAGG + Intergenic
1146261668 17:31426018-31426040 CTTTTGCCACAGATGGTCCTCGG - Intronic
1146672516 17:34751389-34751411 CTTTGGCCCCAGATTGCCTGGGG - Intergenic
1147048639 17:37773844-37773866 CTTTGGCACTAGATGAATCCAGG - Intergenic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1148600283 17:48889021-48889043 CTTTGGACCCAGACAGACCTGGG + Intergenic
1152879605 17:82807677-82807699 CTGTGGCCGCAGAAGCACCCCGG + Intronic
1154412114 18:14147097-14147119 CTGAGGCCCCAGATGAGCCCCGG - Intergenic
1156349942 18:36295485-36295507 CTCTGCCCCCACCTGGACCCTGG - Intergenic
1157272188 18:46284357-46284379 CTTTGGACCCAGATAAACCCAGG + Intergenic
1160802388 19:976435-976457 CTGTGCCCCCAGGGGGACCCTGG + Intergenic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1165504307 19:36215168-36215190 CTTTCGCGCCACGTGGACCCAGG - Exonic
1165824886 19:38700079-38700101 CAAAGGCCCCAGCTGGACCCTGG - Intronic
1166253404 19:41586225-41586247 CTTGGGCCCCAGGGAGACCCAGG + Intronic
1166711570 19:44941025-44941047 CTCTGGCTTCAGATGGACCTGGG - Intergenic
1166740883 19:45114212-45114234 CTGTGGCCCCAGGTGGATTCTGG - Intronic
1166795530 19:45423364-45423386 TTCAGGCTCCAGATGGACCCTGG - Exonic
1167569182 19:50276340-50276362 CTCTGTCCCCAGCTTGACCCAGG - Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1202647029 1_KI270706v1_random:152533-152555 CTGTGGCTGCAGATGGCCCCTGG - Intergenic
925626123 2:5843291-5843313 CTTCGCCACCAGATGGATCCAGG + Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927603748 2:24467419-24467441 ATTTCGCACCAGATGGCCCCAGG + Intergenic
928108234 2:28486644-28486666 CACTGCCCCCAGATGGGCCCAGG - Intronic
929659836 2:43773054-43773076 CTTTGGCGTGAGATGGACCTAGG - Intergenic
931318964 2:61157920-61157942 CTTGGGCTCCAGATGGTCCAGGG - Intronic
931867304 2:66426419-66426441 CTTTCTCCCCAGCTGGACTCGGG - Intergenic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
936245153 2:110820133-110820155 CTATGGTCCCACATGGACCTGGG - Intronic
937643685 2:124242238-124242260 CAGTGGCTCCAGATGGACCTGGG + Exonic
938979883 2:136516274-136516296 CTTTGGGCTCAGATTGACCTGGG + Intergenic
940283448 2:152010701-152010723 CTTTGCCCTCAGATGCACCTGGG - Intronic
941874435 2:170418703-170418725 CTTTGCCCCCAGGTGGCCCAGGG - Intronic
943967390 2:194354278-194354300 CTTGGGCCCCAGGTGGCTCCAGG - Intergenic
946173812 2:217910628-217910650 CTTTGGTTCCAGAGGGTCCCGGG - Intronic
948266771 2:236640836-236640858 CTGTGGCCCCAGCTGGAATCAGG + Intergenic
1173604870 20:44324747-44324769 CCTGTGCCCCAGATGGGCCCAGG - Intergenic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1173822129 20:46026327-46026349 CTCTGGCCCCAGATCTCCCCAGG + Intronic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1174696455 20:52564584-52564606 CTTTGGAACCAAATGGACCTGGG - Intergenic
1175301164 20:57943640-57943662 CTTTGGCCCCACATGAAGCTAGG + Intergenic
1175481249 20:59312798-59312820 GTTTGGAGCCAGAGGGACCCTGG + Intronic
1176056594 20:63152241-63152263 CTTGGGACCAAGATGGAGCCAGG + Intergenic
1176092507 20:63325437-63325459 CTTTGACCCCTGGTGGACCCTGG - Exonic
1176202024 20:63865404-63865426 CCTTCGCCGCAGATGGGCCCAGG + Intronic
1176860897 21:14011164-14011186 CTGAGGCCCCAGATGAGCCCCGG + Intergenic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1179062683 21:37994318-37994340 TTCTGGTCCCAGATGGACACAGG - Intronic
1181102845 22:20552917-20552939 CTAAGGCCCCAGGTTGACCCTGG + Intronic
1182472315 22:30556086-30556108 CTCTGTCCCCAGCAGGACCCCGG - Exonic
1183080114 22:35450812-35450834 TTTTGGAGTCAGATGGACCCGGG - Intergenic
1183420429 22:37708792-37708814 CTCTGGCCTCAGATGGACCTCGG - Intronic
1184101293 22:42342942-42342964 CTTTGGGGTCAGTTGGACCCTGG - Intronic
1184333255 22:43839110-43839132 CATGGGCCCCAGCTGGACGCTGG - Intronic
1184644124 22:45886909-45886931 CCTTGGCCCCAGCCAGACCCAGG + Intergenic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
949903274 3:8837628-8837650 CTCTGCCCCTGGATGGACCCTGG - Intronic
950484937 3:13267570-13267592 CTCTGGCCCCAGAAGGGCACAGG - Intergenic
952912686 3:38204153-38204175 CTTGGGCCCCAGCTGAACACTGG - Intronic
953696579 3:45164688-45164710 CCTGGGTCCCATATGGACCCAGG - Intergenic
954453296 3:50583320-50583342 CTTTACCCCCACCTGGACCCTGG + Exonic
955004191 3:54954093-54954115 CTTTGGCCTCAGGTAAACCCTGG - Intronic
957859344 3:85924474-85924496 CTTTGGCCCCCGATGTAGCTGGG - Intronic
958833219 3:99114804-99114826 TTTTGGGGCCAGATGGACCTAGG + Intergenic
958997932 3:100927301-100927323 CTTTGGAGCCAGAAGGAACCAGG + Intronic
959798059 3:110456740-110456762 TTTTGGACCCATATGGAACCTGG - Intergenic
960036016 3:113103964-113103986 CTTTGGAACTAGTTGGACCCAGG - Intergenic
961331040 3:126138114-126138136 CTGTGGACTCAGATGGTCCCGGG + Intronic
961335767 3:126179083-126179105 CTTTGGCCCCAGAAAGAGCAGGG + Intronic
962358548 3:134715672-134715694 CTTTGGCCCCAAAGGGGTCCTGG + Intronic
963019463 3:140858794-140858816 CTTTAGCACCAGATGCACCCAGG + Intergenic
966917948 3:184594998-184595020 CATTGGCCCCCAAGGGACCCTGG - Intronic
968362796 3:198159607-198159629 CTATGGACCCAGATGGTCCTGGG + Intergenic
969082840 4:4633174-4633196 CCTTGGCCCAAGGTGGACCTAGG + Intergenic
972870430 4:43291398-43291420 CTGTGGCCTCAGAAGGCCCCTGG - Intergenic
974595941 4:64014612-64014634 CTTAGGCCCCAGATAGTCACAGG + Intergenic
975850898 4:78571259-78571281 CTTTGGCCCCCGAAAGACCTGGG + Intronic
981670372 4:147279623-147279645 CTTTGGCCCCAGATGGTGTGGGG - Intergenic
981734304 4:147933624-147933646 TTTCTGCCCCAGATGGACCTGGG + Intronic
981761306 4:148198505-148198527 ATTGAGACCCAGATGGACCCTGG - Intronic
982004359 4:151049753-151049775 GTTAGGCCCCATATGGCCCCTGG - Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
991725171 5:69528624-69528646 CTTTGGAGCTAGATGGACCAGGG + Intronic
992325031 5:75652004-75652026 CTTTGAATCCAGATGAACCCTGG - Intronic
992703365 5:79362910-79362932 CTTTGGTCCCATATCCACCCAGG + Intergenic
997469468 5:134108817-134108839 CTTTGACCCCATAGGGTCCCTGG - Intergenic
999445913 5:151639223-151639245 CTTTGGCCACAGCTGGTCCAAGG - Intergenic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1002564318 5:180101292-180101314 CTTTGGCCCTGGCAGGACCCAGG - Exonic
1007735162 6:43977808-43977830 CTTTGGCCCAAGAGGGATCAGGG - Intergenic
1008664275 6:53700619-53700641 CTTTGGACTCAGATGGCCCTGGG + Intergenic
1009909258 6:69905106-69905128 CTTTGGCCCCTGAAGGCTCCCGG - Intronic
1015791687 6:136969795-136969817 CTTTTCCCCAAGATGGAGCCTGG - Intergenic
1019252887 7:29104-29126 CTATGGACCCAGATGGTCCTGGG - Intergenic
1019652589 7:2168500-2168522 CTGTGGCCCCAGCTGGTCCCTGG + Intronic
1023029537 7:36080260-36080282 CTTTGGCTCCTGTTGGATCCTGG + Intronic
1023054429 7:36280083-36280105 CTTTGGACCAAGATGGGCACTGG + Intronic
1023136928 7:37061953-37061975 CTTTGGACACAGATAAACCCTGG + Intronic
1023923098 7:44645259-44645281 CTGTGGCCACAGATGCATCCTGG + Intronic
1024057847 7:45676814-45676836 CTGTGGCCCCAGCTCCACCCAGG - Intronic
1024232295 7:47371804-47371826 CTCTGGCATCAGATGGACACTGG + Intronic
1026777586 7:73240335-73240357 CTTTGGAGTCACATGGACCCTGG + Intergenic
1027018441 7:74793707-74793729 CTTTGGAGTCACATGGACCCTGG + Intergenic
1027069588 7:75152211-75152233 CTTTGGAGTCACATGGACCCTGG - Intergenic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1034263165 7:149769538-149769560 CCCAGCCCCCAGATGGACCCTGG + Intronic
1034902151 7:154914373-154914395 CTTTGGTTCCAGCGGGACCCAGG + Intergenic
1037578518 8:20230637-20230659 CTGTGGCTCCTGAGGGACCCAGG + Intergenic
1038673896 8:29606114-29606136 CTTTGGCTCCAAATTGACCTTGG - Intergenic
1039024133 8:33239253-33239275 CTTTGGCCTCAGAAAGACCATGG + Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1041860034 8:62502846-62502868 CTTTGTCTTCAGATGGACCAGGG + Intronic
1047979792 8:130168792-130168814 TTATGGCCCCAGAAGGACTCTGG + Intronic
1048911472 8:139139460-139139482 ATGTGTCCCCAGAGGGACCCTGG - Intergenic
1049298628 8:141856996-141857018 CTTTGGCCCCAGAGGCATCAAGG + Intergenic
1052432284 9:28381994-28382016 CTTTGGATACAGATGGACCTAGG + Intronic
1053172185 9:35896042-35896064 CTTTGGGGCCAGAAGGAACCAGG + Intergenic
1053200645 9:36149524-36149546 CTGTGGCCCTCGATGGGCCCCGG + Intronic
1055196184 9:73597056-73597078 CTTAGGCCCGAGATGCATCCAGG - Intergenic
1057835427 9:98440797-98440819 CTGTGGGCCCTGATGGACACTGG - Intronic
1059404577 9:114092050-114092072 GTTGGGACCCAGATGGACCTGGG - Intronic
1060030677 9:120212401-120212423 CTTTGGCCACTGGTTGACCCAGG - Intergenic
1060469377 9:123934786-123934808 CTCTGGAGCCAGATGGACCCAGG + Intergenic
1061211228 9:129194579-129194601 CTTTGGAGGCAGAAGGACCCAGG + Intergenic
1061682743 9:132250944-132250966 CTGTGGCCCCAGGGGGCCCCAGG - Intergenic
1062747483 9:138223270-138223292 CTATGGACCCAGATGGTCCTGGG + Intergenic
1189108068 X:38256809-38256831 CATTGGCCTCAGATGTCCCCAGG - Intronic
1189215518 X:39319767-39319789 CTTTGGCTCCAGATGGAGGGTGG + Intergenic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1199068873 X:143452701-143452723 ATTTGGCCCCAGGTGGATCATGG - Intergenic
1200247537 X:154534123-154534145 CTTCGGCCCCATCTGGAACCGGG - Exonic
1201754400 Y:17470299-17470321 CTGTGGCCCCTAATGGACACAGG - Intergenic
1201847152 Y:18435686-18435708 CTGTGGCCCCTAATGGACACAGG + Intergenic