ID: 1041196939

View in Genome Browser
Species Human (GRCh38)
Location 8:55410206-55410228
Sequence CAGCGAGCAGCAGTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 430}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041196939_1041196943 -3 Left 1041196939 8:55410206-55410228 CCATCCTCCACTGCTGCTCGCTG 0: 1
1: 0
2: 8
3: 75
4: 430
Right 1041196943 8:55410226-55410248 CTGCCAGAAGGTACTCCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041196939 Original CRISPR CAGCGAGCAGCAGTGGAGGA TGG (reversed) Intronic
900465991 1:2825721-2825743 CAGAAAGCAGCAGTGGAGTGGGG + Intergenic
900524463 1:3121735-3121757 CAGCGCGCAGCCGAGGTGGAGGG - Intronic
900661500 1:3786741-3786763 GAAGGAGCAGCAGTGGAGTATGG - Intronic
901205476 1:7492459-7492481 CAGGAGGCAGCAGTGAAGGATGG + Intronic
902534343 1:17110654-17110676 CAGGGAGCTGAAGTGGTGGAAGG - Intronic
902614039 1:17614163-17614185 AAGCGGGCAGCACTGCAGGATGG - Intronic
902644422 1:17788591-17788613 CAGCCAGGTGCAGAGGAGGAGGG + Intronic
902812784 1:18898442-18898464 CAGGGCCCAGCAGTGAAGGATGG - Intronic
902821417 1:18945579-18945601 CATCGAGCAGCAGATGAGCAGGG + Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
902937359 1:19773852-19773874 CAGAGGGAGGCAGTGGAGGATGG + Intronic
903295303 1:22339675-22339697 CAGAAAGCAGCGCTGGAGGAGGG + Intergenic
903334343 1:22614845-22614867 CATTGAGCAGCAGTTGAGAACGG + Intergenic
903500999 1:23800229-23800251 CAGCGGGCAGCGGTGGGGGAAGG - Intronic
904045626 1:27606577-27606599 CAGCGAGCAGGAGGGAAAGAAGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908046373 1:60173936-60173958 CAGCTAGCAGCTGGAGAGGAAGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909433542 1:75616006-75616028 CTGCGAGCAGCAGCGGCGGCCGG + Intergenic
910861566 1:91747376-91747398 CTGCAAGCAGCAGTGAAGGGTGG - Intronic
915231738 1:154450851-154450873 CAGCCAGCATCAGTGCAGGCAGG - Intronic
915462594 1:156079124-156079146 CAGCCATCTGGAGTGGAGGAAGG - Intronic
915713110 1:157920128-157920150 CACAGAGCAGCAGAGGATGAAGG - Intergenic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
916841902 1:168609693-168609715 GAGCCTGCAGCAGGGGAGGAGGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
918247119 1:182670088-182670110 CAGCAAGCGGGATTGGAGGAGGG + Intronic
918923269 1:190744280-190744302 AAGAAAGTAGCAGTGGAGGAGGG - Intergenic
919918642 1:202154697-202154719 AAGAAAGCAGCAGGGGAGGAAGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920831562 1:209470291-209470313 CAAAGAGCAGCTGTGGAGGTAGG - Intergenic
920844373 1:209581511-209581533 AAGAGAGATGCAGTGGAGGAAGG + Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922450821 1:225735830-225735852 CAGCAAGCAGGATTGGAGGCTGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1063000825 10:1920350-1920372 CAGAGAGCAGGGGTGGAGAATGG - Intergenic
1065492130 10:26292675-26292697 CAGAGGGGAGCAGTGGATGACGG + Intronic
1065564942 10:26998840-26998862 GAGTGAGTAGCAGTCGAGGAGGG + Intronic
1067328467 10:45292344-45292366 CAGGGAGCAGCACAGGAGCATGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070247910 10:74749225-74749247 CAGCGAGCTCCAGGGGAGCAGGG - Intergenic
1070604896 10:77891839-77891861 CAGCAAGCAGCAGAGCCGGATGG - Intronic
1070822885 10:79373010-79373032 CAGAGAGCGCCAGAGGAGGAAGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072759252 10:98042327-98042349 CAGTGAGCAGGACTGGGGGATGG - Intergenic
1073664778 10:105518861-105518883 CAGAGAGGAGCAGAGCAGGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075299334 10:121307412-121307434 CAGGGAGCAGAAGGGAAGGATGG - Intergenic
1075985746 10:126783695-126783717 CAGGGAGCAGCTGGGGAAGAAGG - Intergenic
1076297413 10:129397402-129397424 GAGGGAGGAGCAGAGGAGGAGGG + Intergenic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077090241 11:775105-775127 CATCGTGAAACAGTGGAGGAAGG + Exonic
1077409956 11:2399336-2399358 TTGGGAGCAGCAGGGGAGGAGGG - Intergenic
1077436645 11:2542609-2542631 GAGCCAGGAGCAGCGGAGGAGGG - Intronic
1079030477 11:16982649-16982671 CAGAGAGCTGCACAGGAGGACGG - Intronic
1079429266 11:20373116-20373138 CAGAGAACAGCAATGGAGAAAGG + Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081570415 11:44287134-44287156 GAGGGCGGAGCAGTGGAGGACGG - Intronic
1081599865 11:44485577-44485599 CAAAGAGAAGCAGTGAAGGAGGG + Intergenic
1081693897 11:45096057-45096079 CAGTGAGAAGGAGTGGAGGGTGG - Intronic
1083268308 11:61557505-61557527 CAGGGTGCTGGAGTGGAGGAGGG - Intronic
1083451933 11:62752132-62752154 GACAGAGCAGCAGTGGTGGAGGG - Exonic
1083505122 11:63149552-63149574 CAGACATCAGCAATGGAGGAAGG + Intronic
1083920654 11:65780195-65780217 CCGCCAGCAGCAGTGGCCGACGG + Exonic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084935597 11:72584935-72584957 CACAGAGCAGCTGTGGAGGGAGG + Exonic
1085836576 11:79963101-79963123 CAGAGAGCAGCAGAGTGGGATGG + Intergenic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1085931256 11:81086168-81086190 CAGCTAGGAGCAGTGGGGGTAGG + Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087652584 11:100885140-100885162 CAGGGAACAGCAGAGGAGTAAGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1092831306 12:12447218-12447240 CAGGGAGCAGGAGTGGAGGCTGG - Intronic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1093173246 12:15882491-15882513 CAGCAAGCAACAGTCGACGAGGG - Exonic
1095930657 12:47622134-47622156 CAGTGTGCAGCAGAGGGGGAAGG - Intergenic
1096218112 12:49809467-49809489 CAGGGACCAGGAGTGGGGGAGGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096408982 12:51363899-51363921 CAGCTAGCAACAGTGGAGCAAGG - Intronic
1096671204 12:53199229-53199251 CATGGAGCAGCAGAGCAGGAGGG - Intronic
1096758890 12:53823264-53823286 CAGCCAGCAGCAGGGGAGAGTGG + Intergenic
1096816738 12:54206430-54206452 CAGCAAGAAGCAGAGGAGGTGGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098064495 12:66599147-66599169 CTGGGAGCAGGAGTGGAGGTTGG - Intronic
1098369158 12:69738938-69738960 CAGCGAGAAACGGAGGAGGACGG - Intronic
1098580350 12:72092083-72092105 CAACTAGCAGCAGTGGCGGTTGG + Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099088876 12:78279869-78279891 GAGTGTGCACCAGTGGAGGAGGG + Intergenic
1101419233 12:104535657-104535679 CACCGAGCAGAAGGGGAGGGCGG + Intronic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103721011 12:122975419-122975441 CAGAGAGGGGTAGTGGAGGAGGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105019080 12:132804571-132804593 CAGCGGGGACCAGTCGAGGAAGG + Intronic
1106553438 13:30790622-30790644 CATAGAGCAGCAGTGAAAGAGGG - Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107729852 13:43338001-43338023 AAGCCAGCAGCAGTGCAGAAGGG - Intronic
1107947188 13:45429482-45429504 AAGCGACCAGCAAAGGAGGATGG + Intergenic
1109272560 13:60270852-60270874 GAGTGAGAAGCTGTGGAGGAAGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115231471 14:31165411-31165433 CAGAGAGAAGAACTGGAGGAAGG - Intronic
1115788600 14:36854874-36854896 CAGAAAGCTGCAGTGTAGGAGGG + Intronic
1115961556 14:38839150-38839172 CAGCAAGCAGCAGGGAAGGGAGG - Intergenic
1116978610 14:51143217-51143239 CTTCCAGCAGCAGTGGAGGGTGG + Intergenic
1117097574 14:52314183-52314205 CCGCGAGCTGCAGGGGAGGCAGG - Intergenic
1117402318 14:55369682-55369704 TCGCGAGCAGCAGTGCAGGTGGG - Exonic
1118322690 14:64762654-64762676 CAGCCAGCAGCCCTGGAGAAAGG - Intronic
1118818759 14:69331161-69331183 CAGCCTGCAGCAGTCAAGGAAGG + Intronic
1118990095 14:70790164-70790186 CCCTGAGCAGCAGTGGGGGAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119623023 14:76147155-76147177 AAGCAGGCAGCAGTGGAGGAGGG - Intergenic
1119847238 14:77839614-77839636 CAGAGAGCAGCAGTGATGGCAGG + Intronic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120723895 14:87916645-87916667 GGGTGAGCTGCAGTGGAGGAAGG + Intronic
1120762525 14:88298466-88298488 AGGCGTGGAGCAGTGGAGGATGG - Intronic
1122914867 14:104854229-104854251 CAGTCAGGAGCAGTGGAGGGAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124501930 15:30236093-30236115 AAGCCAGCGGCTGTGGAGGAGGG + Intergenic
1124741635 15:32302559-32302581 AAGCCAGCGGCTGTGGAGGAGGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1129138014 15:73571585-73571607 CAGGGAGGAGCAGTGCAGGCAGG + Intronic
1129241294 15:74253641-74253663 CAGTCAGCAGCAGTGGAGCCGGG + Intronic
1129712230 15:77826238-77826260 AACCCAGCAGCAGGGGAGGAGGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130859992 15:87877304-87877326 CAGTGAGCAGCAGTGGCTGGTGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132766377 16:1536400-1536422 CAGGGAGGAGCAGTGGACGCAGG - Intronic
1132769196 16:1551550-1551572 CAGGGTGCAGCGGTGGAGGGAGG + Intronic
1133183935 16:4081689-4081711 CAGGGTGCAGGAGGGGAGGAGGG + Intronic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1134028752 16:10975040-10975062 CAGTGAGGAGAAGTAGAGGAGGG + Intronic
1134240458 16:12502216-12502238 CAGTGAGGGGCGGTGGAGGAGGG + Intronic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1140348659 16:74240401-74240423 CACACAGCAGCAGTGGAGCAGGG + Intergenic
1140412036 16:74746954-74746976 CAGGGAGCAGAAGTGGGGGTTGG + Intronic
1140632429 16:76870236-76870258 AAGTGGGCAGCAGTGGAAGATGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141703856 16:85654288-85654310 CCAGGAGCAGCAGTGGAGGTCGG + Exonic
1142169127 16:88611390-88611412 CAAGGAGCGGCAGCGGAGGAAGG + Exonic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142940517 17:3376798-3376820 CAGCCAGCAGAATTGGGGGAGGG - Intergenic
1143166003 17:4897609-4897631 CAGTCAGCAGCAGTGGGGTAAGG - Exonic
1143309380 17:5975873-5975895 CAGAGAGCAGCTGTGTTGGAGGG - Intronic
1143856338 17:9853369-9853391 CAGGGAACAGCTGTGCAGGACGG + Intronic
1145011557 17:19371141-19371163 CAGGCAGCAGCACTGGAGGGAGG + Intronic
1146499331 17:33351221-33351243 CAGAGAGGAGGAGGGGAGGAGGG - Intronic
1147914220 17:43877129-43877151 CAGTGAGAAGCTGTGGATGAGGG + Intronic
1148050559 17:44768074-44768096 CAGAGAGCAGCATTGGGGCAAGG + Intronic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1148785063 17:50142235-50142257 CAGGGAGGTGGAGTGGAGGAGGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148862729 17:50613002-50613024 CAGAGAGCAGCAAAGGAGGGTGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149681215 17:58508605-58508627 CAATGTGCAGGAGTGGAGGAGGG + Intronic
1149995584 17:61404543-61404565 CAGCGAGCAGGAGGGATGGAGGG + Intronic
1150295298 17:64004105-64004127 AAGAGGGCAGCAGTTGAGGATGG + Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151361987 17:73594388-73594410 TAGGGAGCAGCACTGGGGGAGGG - Intronic
1152178397 17:78802428-78802450 CAGCGGGCAGTAGAAGAGGATGG - Exonic
1152639026 17:81442061-81442083 CGGCCAGCGGCAGAGGAGGACGG + Exonic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154270231 18:12912131-12912153 CAGCAAGCTGTACTGGAGGACGG + Intronic
1157166656 18:45363765-45363787 CCTCGGGCAGCTGTGGAGGATGG + Intronic
1157182836 18:45512579-45512601 TAATGAGCAGCAGTGCAGGAGGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159895585 18:73992618-73992640 CAGCCAGCAGCAGTTGGGGTTGG - Intergenic
1159953849 18:74505951-74505973 CAGCCTGCAGCCCTGGAGGACGG + Exonic
1160510753 18:79452178-79452200 CAGTTAGCAGCAGGGCAGGAGGG + Intronic
1160682438 19:417977-417999 GAGAGAGCAGCCGGGGAGGAGGG - Intronic
1161446715 19:4322873-4322895 CAGGGAGCAGCTGTGGTGTAAGG + Intronic
1162061805 19:8100775-8100797 GAGCGAGGAGGAGGGGAGGATGG + Intronic
1163458155 19:17420676-17420698 CAGGGAGGAGCGGGGGAGGAGGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165067959 19:33240065-33240087 GAGGGAGGAGCAGTGGAGGCGGG + Intergenic
1165392658 19:35547326-35547348 CAGCGAGCAGAGGTGGACGAAGG - Exonic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1166297588 19:41896591-41896613 CAGAGAGCAGCAGAGGAGCATGG - Intronic
1166361758 19:42255437-42255459 CAGTGGGCAGGAGAGGAGGAGGG - Intergenic
1167066528 19:47190474-47190496 CAGTTAGCAGCAGTGGAGGGGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925207696 2:2021276-2021298 CAGAGAGCAGGGGTGGAGTAAGG + Intronic
926781259 2:16474222-16474244 CAGTGAGCTGCAGAGGAGCATGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928706597 2:33956187-33956209 CAGGGAGCAGCAATGGAAGCAGG - Intergenic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930054823 2:47243941-47243963 CAGGGAGCAGGAGCTGAGGAAGG - Intergenic
930100185 2:47597186-47597208 GAGGGAGCAGCATTGAAGGATGG + Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
935605670 2:104970207-104970229 CAGTGAGCAGCAGGGGTTGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936323180 2:111483618-111483640 GAGAGAGCAGCAGAGAAGGATGG + Intergenic
936573548 2:113635462-113635484 CAGCAGGCAACAGTGGAGGGAGG - Intronic
936758164 2:115739543-115739565 GAGCAAGCAGCTGTAGAGGAAGG - Intronic
937128047 2:119486863-119486885 CTGTGGGCAGCCGTGGAGGATGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942079090 2:172383820-172383842 CAGGGAGGAGCAGAGGAAGAAGG + Intergenic
942303679 2:174586169-174586191 CAGGGAGCAGCAGCTGAGGCGGG + Intronic
942966940 2:181906298-181906320 CAGCGGGTGTCAGTGGAGGATGG + Intronic
944157874 2:196626872-196626894 TAGCGAACAGCAGTGGAAAATGG - Intergenic
944414337 2:199467854-199467876 CCGAGAGGAGCAGTGGAGGCAGG - Intronic
946006867 2:216532798-216532820 CAGAGAGAAGCAGTGAAGGTGGG + Intronic
946019469 2:216631506-216631528 CAGAGAGCAGCAGGGGAGGCAGG - Intergenic
946295837 2:218782696-218782718 CAGTGAGCAGAGGTTGAGGAGGG + Intronic
946326549 2:218987396-218987418 CAGCGCTCAGCAGGGTAGGAAGG - Intergenic
946371854 2:219285925-219285947 CAGCGGCAAGCTGTGGAGGATGG - Exonic
947758946 2:232589139-232589161 CAGCGAGAGGCAGTGCTGGATGG - Intergenic
948047332 2:234953897-234953919 CAGAAAGCAGAGGTGGAGGAGGG - Intronic
948217254 2:236240828-236240850 CAGCCAGCATCAGTAGAGGCAGG - Intronic
948489805 2:238305282-238305304 CAGTGAGTAGCAGTGGTGGCAGG - Intergenic
949006555 2:241652687-241652709 GAGCGATCAGCAGTGGAGCGAGG + Intronic
1170540469 20:17382531-17382553 AAGGGAGCAGCAGTCAAGGATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171343907 20:24451523-24451545 CAGGCAGCAGCAGTGGTGAATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171966770 20:31536450-31536472 CAGGGAGCAGGAGAGGGGGACGG - Intronic
1172441144 20:34967562-34967584 GACCAAGCAGCAGTGGAGGGCGG - Intergenic
1172815400 20:37682234-37682256 TTGAGAGCAGCAGGGGAGGATGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172972121 20:38881268-38881290 CAGGGAGGAGCAGTGGTGGGTGG + Intronic
1174165482 20:48580884-48580906 AAGAGAGCAGGAGGGGAGGATGG - Intergenic
1174264582 20:49322141-49322163 CAGCTAGAAGCACTGGGGGATGG + Intergenic
1175120272 20:56711146-56711168 CAGCAAGGAGGAGAGGAGGAGGG - Intergenic
1175608324 20:60329657-60329679 CAGAAAGCAGCAGAGCAGGAAGG + Intergenic
1175934850 20:62509862-62509884 CGGGGTGGAGCAGTGGAGGATGG - Intergenic
1176166276 20:63675694-63675716 CAGGGAGTTGCAGTGGGGGAAGG + Intronic
1176417592 21:6486842-6486864 CAGCCAGCAGAACTGAAGGACGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178132999 21:29594483-29594505 CAGTGAGAAGTAGTGGAGGGTGG + Intronic
1179359771 21:40694932-40694954 CAGAGAGGAGAAGAGGAGGATGG + Intronic
1179693088 21:43095173-43095195 CAGCCAGCAGAACTGAAGGACGG - Intronic
1179840570 21:44070278-44070300 CAGCAATCAGGAGAGGAGGAGGG + Intronic
1179950978 21:44708718-44708740 CAGGGAGCAGCATTCGGGGAGGG - Intronic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1181727469 22:24821430-24821452 GAACGTGCAGCATTGGAGGAAGG + Intronic
1182349637 22:29692092-29692114 GGGCGAGCAGCAGTGGCCGAAGG + Intronic
1183192308 22:36329480-36329502 CAGGGAGACGCAGTGGGGGAGGG - Intronic
1183302626 22:37065790-37065812 CATTAGGCAGCAGTGGAGGAAGG + Exonic
1183740550 22:39666469-39666491 CAGAGAGCAGCGGTGGGTGAGGG - Intronic
1184189838 22:42887296-42887318 CAGTGAGGAACAGTGGAGAAAGG + Intronic
1184782952 22:46658248-46658270 CCGCGAGCGGCAGCGGCGGATGG + Exonic
1184945892 22:47803528-47803550 CAGCGAGGGGCCGAGGAGGATGG + Intergenic
1185147999 22:49149737-49149759 CAGAGAGAAGCAGGGGAGGGAGG + Intergenic
1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG + Intronic
949100085 3:133033-133055 CAGGGAGGAGCAGTAGGGGATGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949996100 3:9618770-9618792 CAGAGAGTAGCAGGGGAGGGTGG - Intergenic
950127704 3:10520296-10520318 GAGCAAGCAGCAGGGGAGGGGGG + Intronic
950667698 3:14507184-14507206 CAGTGAGCACCAGTGGAGCCAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951732306 3:25823802-25823824 CAGGAAGCAGGGGTGGAGGATGG + Intergenic
952071591 3:29643527-29643549 CAGAATGCAGCAGAGGAGGAAGG + Intronic
952927839 3:38334836-38334858 GACAGAGCCGCAGTGGAGGAAGG + Intergenic
953345564 3:42172508-42172530 CAGTGTGCAGCAATGGGGGAGGG - Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953816659 3:46163531-46163553 CAGTGAGCAGGAGTGGATCAGGG + Intergenic
954400446 3:50316913-50316935 CAGCCAGCAGCAGGGGAGCAGGG - Intergenic
954802321 3:53194365-53194387 CAGCCAGAGGCAGTGGAGGGTGG + Intergenic
955362018 3:58283784-58283806 CATTGAGCAGAGGTGGAGGATGG + Intronic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
956807899 3:72835364-72835386 CAGGGAGCAGCAGTGGAAGAGGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959316261 3:104811055-104811077 CATGGAGCAGTAGGGGAGGAAGG + Intergenic
959406341 3:105966161-105966183 CAGCGATCGGCAGTGGTTGACGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960625371 3:119677040-119677062 CAGGGAGGAGGAGTGGGGGAAGG + Intronic
961319961 3:126065964-126065986 CAGGCAGCAGCCCTGGAGGAAGG + Intronic
961553790 3:127683809-127683831 CAGCGAGCAGCAAGTGGGGAAGG + Intergenic
962672427 3:137722663-137722685 CAGGGGGCAGCAGTGGGTGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963580017 3:147113867-147113889 CAGTTGGCAGAAGTGGAGGAGGG + Intergenic
964314515 3:155429222-155429244 TAGCGTGTATCAGTGGAGGAGGG - Intronic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
968066365 3:195761780-195761802 ACGCGGGCAGCGGTGGAGGAGGG + Intronic
968489489 4:882419-882441 CACCGAGCAGGAGGGGAGGTGGG + Intronic
968552824 4:1232791-1232813 CAGCGAGCATCTGTGGTGGGGGG + Intronic
968566562 4:1316575-1316597 CAGGGAGCAGCATGGGAGGGAGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969502036 4:7559144-7559166 CAGAGTGCAGCAGTGGGTGATGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970250779 4:14113455-14113477 CAGCAAGAAGCATGGGAGGAAGG - Intergenic
970946576 4:21699862-21699884 CAGGGAGCAAGAGTGGAAGAAGG + Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
971317633 4:25580704-25580726 CAGGGATCAGCAGTGGAGTTGGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973339861 4:48993125-48993147 CACAGAGCAGAAATGGAGGAAGG - Intronic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975811205 4:78171722-78171744 CAGCCAGCAGCAGGAGAGGGTGG - Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977555408 4:98483244-98483266 CAGTGAGCAGCTGAGGAGGCAGG + Intronic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977858658 4:101927882-101927904 CAACGAGCAGCATTTGAGGTAGG + Intronic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979388676 4:120100623-120100645 CAGAGAGCTGCAGTGTAGGTGGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
987026928 5:13936846-13936868 CAGCCAGCAGAAGTGGATGGAGG + Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990341535 5:54827952-54827974 AAGAAAGCAGCAGTGGAGGTGGG + Intergenic
991180892 5:63749327-63749349 CAGTGAGCTGAAGTGGGGGAAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
995229269 5:109740229-109740251 CAGGGATCAGCAGTTGGGGAAGG + Intronic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997284703 5:132669702-132669724 CAGAGGGCAGAAGTGGGGGATGG - Intergenic
1001410099 5:171505364-171505386 CAAGGAGCAACAGTGGAGGTTGG + Intergenic
1001489915 5:172148092-172148114 CAGACAGTAGCAGTGTAGGAGGG - Intronic
1002426348 5:179178443-179178465 CAGGGATGATCAGTGGAGGAGGG - Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005695629 6:28350174-28350196 CTGCGAGAAGCCGTGGGGGAGGG + Intronic
1006173651 6:32109347-32109369 CAGCGAGCAGGGGAGGAGAAGGG + Intronic
1006470727 6:34227261-34227283 CAGGGAGCAGGAGAGGAGGTTGG + Intergenic
1006832504 6:36977360-36977382 CAGAGAGCAGGAGAGGAAGAGGG + Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1006924992 6:37649190-37649212 CAGCGAGCAGCGCAGGAGCACGG + Exonic
1007226825 6:40321037-40321059 CAGCCACCAGCAGGGGAGAAGGG + Intergenic
1007468450 6:42071970-42071992 CAGACAGCAGGAGTGTAGGAAGG + Intronic
1007917264 6:45573091-45573113 CAGCCAGAAGCAGAGGAGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011556492 6:88575225-88575247 CAGAGAGCAGCCGTGGAAGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013351469 6:109309789-109309811 CTGGGAGCAACAGTGGAGCAGGG + Intergenic
1013430293 6:110049470-110049492 CAGGGAGGCGCAGTGGGGGAGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015992129 6:138956416-138956438 CTGTGAGCAGCAGTGGAGATGGG - Intronic
1016885643 6:148957020-148957042 CAGCGACCAGCAGAAGAGCAGGG + Intronic
1017664345 6:156705027-156705049 TAGGTAGCAGCAGTAGAGGAAGG - Intergenic
1018205778 6:161436096-161436118 CAGAGAGCAGGGGAGGAGGATGG + Intronic
1018980317 6:168596570-168596592 CGGAGAGCAGCAGCTGAGGATGG - Intronic
1019135929 6:169907711-169907733 CAGCAGGAAGCAGTGGAGGAAGG + Intergenic
1019313402 7:373717-373739 CAGCGAGGGAAAGTGGAGGAGGG + Intergenic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1019932571 7:4233771-4233793 CAGGGAGCAGCCCAGGAGGATGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024214695 7:47238671-47238693 CTGCGAGCAGCAGTGCATGTCGG + Intergenic
1024246246 7:47472440-47472462 CAGTGAGTACCAGTGAAGGAGGG - Intronic
1024556211 7:50605303-50605325 CAGAGCGCAGCCCTGGAGGAGGG - Exonic
1024628756 7:51230526-51230548 CCCCGAGCAGCAGTGGAGCAGGG - Intronic
1025234075 7:57221956-57221978 CATGGAGAAGCAATGGAGGACGG + Intergenic
1027160492 7:75798865-75798887 CAGGGAGGAGGAGAGGAGGAGGG + Intergenic
1027390270 7:77696859-77696881 GAGCGTGCAGCAGCGTAGGAGGG - Exonic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030307194 7:108030909-108030931 CAGCGATCAGGGCTGGAGGATGG - Exonic
1030805458 7:113912627-113912649 CAGTTAGCAGAAGTGGAGGAAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031416655 7:121503800-121503822 GAGAGAGCAGCAGTGGATGGTGG + Intergenic
1033174826 7:139114240-139114262 CTTTGAGCAGCAGTGGGGGAGGG + Intergenic
1033220124 7:139522275-139522297 GAGGGAGCAAGAGTGGAGGATGG + Intergenic
1033801670 7:144909180-144909202 CAGGGAGCAGCAGGTGGGGAAGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034296932 7:149981923-149981945 CATGAGGCAGCAGTGGAGGAAGG - Intergenic
1034516607 7:151585841-151585863 CAGGGAGCAGAAGTACAGGAAGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034716642 7:153249263-153249285 GAAAGAGCAGCAGTTGAGGAGGG + Intergenic
1034938413 7:155214454-155214476 CAGAGGGCAGCAGCGAAGGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035573148 8:687582-687604 CAGGGAGCAGGACTGGAGGGAGG + Intronic
1035743003 8:1943320-1943342 GGGCGAGGAGCAGGGGAGGAAGG + Intronic
1035777447 8:2199248-2199270 CACCGAGCAGCACTGCATGATGG + Intergenic
1036208543 8:6823596-6823618 CTGCCAGCAGCTCTGGAGGATGG - Exonic
1036615194 8:10382300-10382322 AAGAGAGCCGCAGTGCAGGAGGG - Intronic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037718664 8:21422183-21422205 CAGAGAGCTTCAGGGGAGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040434871 8:47380483-47380505 CACCAAGCAGGAGTGGAGGGTGG - Intronic
1041144061 8:54853325-54853347 CAGGAAGCAGCAGTGAAGGAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041707800 8:60865077-60865099 GAGCGAGCAGAAGAGGAAGAAGG + Exonic
1041722944 8:60992854-60992876 GAAAGAGCAGCAGTGAAGGAAGG + Intergenic
1041794199 8:61729111-61729133 CAGGGAGCAGGAGTAGGGGAGGG + Intergenic
1042361280 8:67885861-67885883 CAGCAAGCAGCAGTGGAGTTTGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045328873 8:101138047-101138069 CATGGAGCAGCAAGGGAGGAAGG - Intergenic
1045534694 8:103016663-103016685 CAGAGAACAGCTGTGCAGGATGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048553410 8:135454718-135454740 CCACCAGCAGCTGTGGAGGAGGG - Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1051121509 9:13757059-13757081 GAGAGAGAAGCAGTGGTGGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1055342454 9:75298681-75298703 CAGTGATCAGCAGAGGAGGGAGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056968109 9:91180770-91180792 CAGCGAGCAGAGGTGCAGGAAGG - Intergenic
1058531231 9:105906698-105906720 CAGTGAGAAAGAGTGGAGGAAGG + Intergenic
1059752545 9:117261772-117261794 CAGCTAGCAGCAGGCAAGGAGGG + Intronic
1060228793 9:121812355-121812377 CAGCAAGCAGCAGGGGAGCCCGG + Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061015295 9:127977836-127977858 CATGGAGCAGGAGTGGAGGTGGG - Intronic
1061309493 9:129752947-129752969 CAGCGTGCTGCAGAGCAGGAAGG + Exonic
1061407384 9:130399909-130399931 CAGCGGGCAGCTGTGGAGGGAGG - Intronic
1061424295 9:130489562-130489584 CAGTGGGCGGCAGGGGAGGAAGG - Intronic
1061481315 9:130898897-130898919 GAGGGAGGAGCAGAGGAGGAAGG - Intergenic
1061489332 9:130936551-130936573 CAGGGAGCAGCAGAGGAAGGCGG + Intronic
1062405008 9:136392019-136392041 CAACAAGCAGGAGTGGAGCAGGG - Exonic
1062449817 9:136610749-136610771 CAGCGCTCAGCAGTGGACGGTGG + Intergenic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1185598408 X:1322691-1322713 CAGTGGGCAGCTTTGGAGGAAGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188237860 X:27751515-27751537 CAGGGAGCAGCAGTGTAGACAGG - Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191672378 X:63760202-63760224 AAGTGAGCAGCAGTGGAGATCGG - Intronic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193773750 X:85619408-85619430 CAGTGAGAAGTAGTGGAGGCAGG - Intergenic
1193894779 X:87099888-87099910 CAGCCAGCACCAGTGCAGGGAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195441217 X:104900790-104900812 AAGCCAGCATCAGTGGAGCAAGG + Intronic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198118218 X:133565249-133565271 GAGAGAGCAGCTGTTGAGGAGGG - Intronic
1199381855 X:147180976-147180998 CACCGAGCAGCGGAGGAGAAAGG + Intergenic
1199966204 X:152823316-152823338 CAGAGAGCCGGAGGGGAGGAAGG - Intergenic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1201192659 Y:11459807-11459829 CTGAGAGCAGCAGTTGAGGCTGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic