ID: 1041200157 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:55446006-55446028 |
| Sequence | CTGTCTGAAGGGCTGATTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041200153_1041200157 | -1 | Left | 1041200153 | 8:55445984-55446006 | CCTTGTGCTGTGTGAGCCATTTC | 0: 1 1: 1 2: 0 3: 24 4: 301 |
||
| Right | 1041200157 | 8:55446006-55446028 | CTGTCTGAAGGGCTGATTGATGG | No data | ||||
| 1041200152_1041200157 | 13 | Left | 1041200152 | 8:55445970-55445992 | CCAAAGAAAAATCTCCTTGTGCT | 0: 1 1: 0 2: 6 3: 35 4: 258 |
||
| Right | 1041200157 | 8:55446006-55446028 | CTGTCTGAAGGGCTGATTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041200157 | Original CRISPR | CTGTCTGAAGGGCTGATTGA TGG | Intronic | ||
| No off target data available for this crispr | |||||