ID: 1041200157

View in Genome Browser
Species Human (GRCh38)
Location 8:55446006-55446028
Sequence CTGTCTGAAGGGCTGATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041200153_1041200157 -1 Left 1041200153 8:55445984-55446006 CCTTGTGCTGTGTGAGCCATTTC 0: 1
1: 1
2: 0
3: 24
4: 301
Right 1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG No data
1041200152_1041200157 13 Left 1041200152 8:55445970-55445992 CCAAAGAAAAATCTCCTTGTGCT 0: 1
1: 0
2: 6
3: 35
4: 258
Right 1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041200157 Original CRISPR CTGTCTGAAGGGCTGATTGA TGG Intronic
No off target data available for this crispr