ID: 1041201117

View in Genome Browser
Species Human (GRCh38)
Location 8:55452564-55452586
Sequence CGGTGCAGCGGGAGAACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041201117_1041201127 14 Left 1041201117 8:55452564-55452586 CCTCCGGTTCTCCCGCTGCACCG 0: 1
1: 0
2: 1
3: 29
4: 175
Right 1041201127 8:55452601-55452623 ATGTTTATCTGGACGATGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 66
1041201117_1041201126 3 Left 1041201117 8:55452564-55452586 CCTCCGGTTCTCCCGCTGCACCG 0: 1
1: 0
2: 1
3: 29
4: 175
Right 1041201126 8:55452590-55452612 CCAGGGTCTTAATGTTTATCTGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041201117 Original CRISPR CGGTGCAGCGGGAGAACCGG AGG (reversed) Intronic
901436067 1:9248148-9248170 AGCTGCAGCGGGAGCACCCGAGG + Intronic
901626925 1:10629884-10629906 GGGTGCAGAGGGAGGACCGCCGG + Exonic
901639714 1:10687096-10687118 TAGTGCAGCGGGAGAGCAGGAGG - Intronic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
904460719 1:30678205-30678227 AGGTGCAGTGGGAGAAACTGAGG - Intergenic
904611412 1:31728067-31728089 CGTTGCAGAGGGAGAAGCGGTGG - Exonic
1062903799 10:1166268-1166290 GGGAGCAGCGGGAGGACCAGGGG + Intergenic
1063373146 10:5534624-5534646 CTGTGCAGAGGGAGAAACTGAGG - Intergenic
1064277042 10:13915814-13915836 CTCTGCAGCGGGAGCACAGGTGG - Intronic
1069748588 10:70731705-70731727 GGGTGCAGCGGGGGAGCTGGAGG - Intronic
1076476411 10:130756807-130756829 AGGTGCAGGCGGAGAACCAGGGG - Intergenic
1076564127 10:131386638-131386660 AGGAGCAGAGGGAGAAGCGGAGG + Intergenic
1076993589 11:288231-288253 CGGTGCAGCCGGAGACGCCGGGG - Intergenic
1079076623 11:17388820-17388842 AGGTGAGGCGGGAGACCCGGAGG - Intronic
1092181699 12:6451034-6451056 TGGTGCAGGGGCAGGACCGGAGG - Intronic
1109923721 13:69106167-69106189 CAGTGCAGAGAGAGAACCTGTGG + Intergenic
1112507871 13:99985617-99985639 GGGGGCAGCGGGACAGCCGGGGG + Exonic
1114658724 14:24331471-24331493 GTGTGCAGCGGGAGGACCTGGGG - Intronic
1121116817 14:91349458-91349480 CTGTTCAGAGGGAGAAACGGGGG + Intronic
1122359800 14:101152479-101152501 GGGTGCACCAGGAGAACCGGGGG + Intergenic
1124341699 15:28894177-28894199 CTCTGCAGTGGTAGAACCGGGGG + Intronic
1125200760 15:37099093-37099115 AGCGGCAGCAGGAGAACCGGGGG + Intronic
1131074942 15:89489626-89489648 CAGAGCAGCTGGAGCACCGGGGG - Intronic
1131517494 15:93088965-93088987 CGGGGCTGCGGGAGAAGAGGGGG + Intronic
1132838063 16:1964589-1964611 CGGTGCAGCGGGGGGGCCCGGGG - Exonic
1134065402 16:11225236-11225258 CAGTGCAGCTGGTGAAGCGGGGG - Intergenic
1143030948 17:3966809-3966831 CGGTGGAGCGGGAGAGGCTGGGG - Intergenic
1143089381 17:4439924-4439946 GGGTGCCGCGGGAGAGCAGGGGG + Intronic
1147187465 17:38720399-38720421 CGCTGCAGAAGGAGAACCAGCGG + Exonic
1147424952 17:40342027-40342049 GGCTGCAGCGGGAGAAACGCAGG - Intronic
1147658329 17:42103730-42103752 CAGCCCAGCGGGAGAACCAGCGG - Exonic
1148334542 17:46832608-46832630 CGGTGCAGCGGCAGGGGCGGGGG - Intronic
1151764490 17:76125128-76125150 AGGTGAAGCGGGAGAGCGGGAGG + Intergenic
1152701067 17:81819954-81819976 CGGTGCATCGGGTGAAGGGGTGG + Intergenic
1155654531 18:28177835-28177857 CGGCGCAGGGCGAGGACCGGCGG - Intergenic
1157384399 18:47248875-47248897 CGGTGCAACTGGAGATCCTGCGG - Exonic
1160878792 19:1310310-1310332 GGGGGCAGCGGGGGAACCGCGGG + Intergenic
1161262201 19:3344236-3344258 CTGGGCACCGGGACAACCGGTGG + Intergenic
1163585473 19:18161311-18161333 CGGTGCAGCGGCAGCGTCGGTGG - Exonic
1166039331 19:40192261-40192283 GGGTGCAGCGGGGGCGCCGGGGG - Exonic
1166949395 19:46416532-46416554 CGGGGCCGCGGGAGGCCCGGGGG - Intergenic
1167271425 19:48508693-48508715 CGGTCCAGAGGAAGAACCTGAGG + Intronic
925657295 2:6164074-6164096 CTGCGCAGCAGGAGAACTGGAGG - Intergenic
925959108 2:8998593-8998615 CGGTGCAGGGGAAGAGCGGGGGG + Intronic
932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG + Exonic
943639553 2:190343680-190343702 CGGTCCCGCGGGAAAGCCGGGGG + Exonic
947919226 2:233854784-233854806 CGGTGCTGTGCGAGATCCGGTGG + Intergenic
949070342 2:242020713-242020735 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
949070375 2:242020871-242020893 CCGTGCAGCTGGAGACCCGCGGG + Intergenic
949070388 2:242020919-242020941 CCGTGCAGCTGGAGACCCTGGGG + Intergenic
949070635 2:242022153-242022175 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
949070728 2:242022564-242022586 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
949070739 2:242022610-242022632 CTGTGAAGCTGGAGACCCGGGGG + Intergenic
949070795 2:242022871-242022893 CCGTGCAGCTGGAGACCTGGGGG + Intergenic
949070806 2:242022918-242022940 TGGTGCAGCTGGAGACCTGGGGG + Intergenic
1171499954 20:25585591-25585613 CGGCGCAGTGGGCGAACAGGGGG + Intergenic
1173139495 20:40469946-40469968 CGGTGCAGTGGGAGGACCTTTGG + Intergenic
1175247980 20:57592763-57592785 TGGTGCAGTGGGAGAACAAGCGG + Intergenic
1181977129 22:26738007-26738029 CGGTGCAGAGGGAGACCAGTCGG + Intergenic
1183627655 22:39014493-39014515 GGGGGCAGCGGGGGAACCAGGGG - Intronic
1184508652 22:44919022-44919044 GGGTGCAGGGTGAGAAACGGAGG - Intronic
1184823505 22:46931054-46931076 CGGTCCAGAGGTAGAACAGGAGG - Intronic
1185371228 22:50461814-50461836 CCGTGCAGCGGGAGAGCCGGAGG - Exonic
949513215 3:4784408-4784430 CAGTGCAGAGGGAGATCCGAAGG + Intronic
953099452 3:39810258-39810280 CTGTGCTGCGGGCGCACCGGCGG + Intronic
953703387 3:45213594-45213616 CAGTGCAGCGGCAGAGCCTGTGG + Intergenic
964015110 3:151935186-151935208 GGGTGAAGCGGGAGAAGTGGAGG + Intergenic
966826275 3:183967525-183967547 CTGTGAAGGGGGAGAACTGGGGG + Intronic
968049797 3:195646840-195646862 CTGTGCAGCTGGAGATCCGGCGG + Intergenic
968049871 3:195647200-195647222 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968049882 3:195647247-195647269 CCGTGCAGCTGGAGACCCAGTGG - Intergenic
968049892 3:195647294-195647316 CCGTGAAGCTGGAGACCCGGTGG - Intergenic
968049926 3:195647435-195647457 CCGTGCAGCTGGAGACCCGCGGG - Intergenic
968049937 3:195647482-195647504 CCGTGCAGCTGGAGACCCGGCGG - Intergenic
968049963 3:195647607-195647629 CTGTGCAGCCGGAGACCCAGGGG + Intergenic
968049992 3:195647749-195647771 CTGTGCAGCTGGAGACCCGCGGG + Intergenic
968050048 3:195648029-195648051 CCGTGCATCGGGAGACCCGGTGG + Intergenic
968050059 3:195648076-195648098 CCGTGCAGCTGGAGACCCTGTGG + Intergenic
968050066 3:195648123-195648145 CCGTGCAGCTGGAGACCCTGTGG + Intergenic
968050074 3:195648170-195648192 CTGTGCAGCTGGAGATCTGGTGG + Intergenic
968050154 3:195648549-195648571 CTGTGCAGCTGGAGACCCTGTGG + Intergenic
968050168 3:195648623-195648645 CCATGCAGCTGGAGACCCGGTGG + Intergenic
968050229 3:195648905-195648927 CAGTGCAGCTGGAGACCCGGCGG + Intergenic
968050239 3:195648952-195648974 CCGTGCAGCTGGAGATCTGGTGG + Intergenic
968097080 3:195939809-195939831 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
968097091 3:195939856-195939878 CAGTGCACCTGGAGACCCGGCGG - Intergenic
968097131 3:195940044-195940066 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968097140 3:195940091-195940113 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
968097148 3:195940138-195940160 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
968097166 3:195940231-195940253 CGGTGTAGCTGGAGACCCGGGGG - Intergenic
968097178 3:195940277-195940299 CCGTGGAGCTGGAGACCCGGCGG - Intergenic
968097218 3:195940465-195940487 CCGTGCAGCTGGAGACCTGGCGG - Intergenic
968097229 3:195940512-195940534 CCGTGCACCTGGAGACCCGGCGG - Intergenic
968097293 3:195940841-195940863 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
968097322 3:195940983-195941005 CTGTGCAGCTGGAGACCCGGGGG - Intergenic
968097351 3:195941108-195941130 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968097362 3:195941155-195941177 CCGTGCAGCTGGAGACCTGGTGG + Intergenic
968097383 3:195941249-195941271 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968097394 3:195941296-195941318 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968097417 3:195941390-195941412 CCGTGCAGCTGGATACCCGGTGG + Intergenic
968097428 3:195941437-195941459 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968097439 3:195941484-195941506 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968097495 3:195941749-195941771 CTGTGCAGGTGGAGATCCGGCGG - Intergenic
968105599 3:195999354-195999376 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968105682 3:195999776-195999798 CCGTGAAGCTGGAGACCCGGGGG - Intergenic
968105745 3:196000067-196000089 CGGTGCAGCTGGAGACCCAGCGG - Intergenic
968105752 3:196000113-196000135 TGGTGCAGCTGGAGACCCAGGGG - Intergenic
968105810 3:196000355-196000377 CCGTGCAGCTGGAGACCTGGTGG - Intergenic
968105819 3:196000402-196000424 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
968105828 3:196000449-196000471 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
968105838 3:196000496-196000518 CGGTGTAGCTGGAGACCCAGGGG - Intergenic
968105864 3:196000589-196000611 CTGTGCATCTGGAGACCCGGTGG - Intergenic
968105934 3:196000946-196000968 CTGTGCAGCTGGAGATCCGGCGG - Intergenic
968303867 3:197636889-197636911 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
968303877 3:197636936-197636958 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968303939 3:197637218-197637240 CCATGCAGCTGGAGACCCGGTGG - Intergenic
968303953 3:197637292-197637314 CTGTGCAGCTGGAGACCCTGTGG - Intergenic
968304033 3:197637671-197637693 CCGTGCAGCTGGAGACCTGGTGG - Intergenic
968304042 3:197637718-197637740 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
968304050 3:197637765-197637787 CCGTGCAGCTGGAGATCCTGTGG - Intergenic
968304056 3:197637812-197637834 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
968304064 3:197637859-197637881 CCGTGCAGCTGGAGATCCTGTGG - Intergenic
968304072 3:197637906-197637928 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
968304139 3:197638234-197638256 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
968304168 3:197638376-197638398 CTGTGCAGCCGGAGACCCAGGGG - Intergenic
968304194 3:197638501-197638523 TCGTGCAGCTGGAGACCCGGCGG + Intergenic
968304205 3:197638548-197638570 CCGTGCAGCTGGAGACCCGGTGG + Intergenic
968304227 3:197638642-197638664 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304238 3:197638689-197638711 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304249 3:197638736-197638758 CCATGCAGCTGGAGACCCGGTGG + Intergenic
968304259 3:197638783-197638805 CCGTGCAGCTGGAGACCCGATGG + Intergenic
968304281 3:197638877-197638899 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304294 3:197638924-197638946 CCGTGCAGCTGGAGACTCGGGGG + Intergenic
968304337 3:197639142-197639164 CTGTGCAGCTGGAGATCCGGCGG - Intergenic
969107993 4:4822483-4822505 CAGTGCAGCGGGAGAAATGCAGG + Intergenic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
981782094 4:148442280-148442302 CCCTGCAGCGGGAGAGCCCGAGG + Exonic
984975649 4:185228030-185228052 AGGTGCAGAGGGAGGACCGAGGG + Intronic
985506228 5:282255-282277 TGGTGCAGCGGAAAAATCGGGGG + Intronic
985506507 5:284639-284661 CCGTGCAGCTGGAGACCGGGCGG + Intronic
985506553 5:284854-284876 CCGTGCAGCTGGAGACCCCGCGG + Intronic
985506594 5:285091-285113 CTGTGCAGCTGGAGACCTGGTGG - Intronic
985506612 5:285170-285192 CCGTGCAGCTGGAGACCCAGAGG + Intronic
985506627 5:285264-285286 CTGTGCAGCTGGAGACCCGGGGG + Intronic
985506666 5:285451-285473 CCATGCAGCTGGAGACCCGGCGG + Intronic
985506676 5:285498-285520 CCGTGCAGCTGGAGACCTGGTGG + Intronic
985506718 5:285685-285707 CCGTGCAGCTGGCGACCCGGGGG + Intronic
985506756 5:285882-285904 CTGTGCAGCTGGAGACCCAGGGG + Intronic
985506762 5:285929-285951 CTGTGCAGCTTGAGACCCGGCGG + Intronic
985506807 5:286123-286145 CTGTGCAGCTGGAGACCCGGGGG + Intronic
985506834 5:286262-286284 CTGTGCAGCTGGAGACCCAGCGG + Intronic
985506854 5:286354-286376 CCGTGCAGCTGGAGATCCGGGGG + Intronic
985506888 5:286542-286564 CTGTGCAGCTGGAGACCCGTGGG + Intronic
985740979 5:1617375-1617397 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
985740999 5:1617469-1617491 CCATGCAGCTGGAGACCCGGCGG - Intergenic
985741008 5:1617516-1617538 CCGTGCAGCTGGAGATCTGGTGG - Intergenic
985741038 5:1617657-1617679 CCGTGAAGCTGGAGACCCGGCGG - Intergenic
985741114 5:1618033-1618055 CCGTGGAGCTGGAGACCCGGGGG - Intergenic
985741158 5:1618222-1618244 CCATGCAGCTGGAGACCCGGTGG - Intergenic
985741173 5:1618296-1618318 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
985741182 5:1618343-1618365 TGGTGCAGCTGGAGACCCAGGGG - Intergenic
985741214 5:1618487-1618509 CCGTGCATCTGGAGAACCGGTGG - Intergenic
985741276 5:1618764-1618786 CCGTGCATCTGGAGACCCGGTGG - Intergenic
985741299 5:1618859-1618881 CTGTGCATCTGGAGACCCGGTGG - Intergenic
985741341 5:1619094-1619116 CTGTGCATCTGGAGACCCGGTGG - Intergenic
985741352 5:1619141-1619163 CCATGCAGCTGGAGACCCGGGGG - Intergenic
985741369 5:1619215-1619237 CCGTGCAGCTGGAGACCCTGTGG - Intergenic
985741410 5:1619407-1619429 CCGTGCATCTGGAGGACCGGTGG - Intergenic
985741443 5:1619548-1619570 CCGTGCAGCTGGAGACCCAGCGG - Intergenic
985741454 5:1619595-1619617 CCGTGCACCTGGAGACCCGGCGG - Intergenic
985741474 5:1619689-1619711 CCATGCAGCTGGAGACCCGGCGG - Intergenic
985741490 5:1619783-1619805 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
985741518 5:1619926-1619948 CTGTGCAGCTGGAGACCCGGGGG - Intergenic
985741545 5:1620051-1620073 CCGTGCAGCTGAAGACCCGGTGG + Intergenic
985741555 5:1620098-1620120 CTGTGCAGCTGGATACCCGGTGG + Intergenic
985741565 5:1620145-1620167 CTGTGAAGCTGGAGACCCGGTGG + Intergenic
985741614 5:1620382-1620404 CTGTGCAGCTGGAGATCCGGTGG - Intergenic
985975947 5:3419194-3419216 TGGGGCAGTGTGAGAACCGGTGG + Intergenic
987061976 5:14251639-14251661 GGGTGCAGGGGGAGAAGAGGTGG + Intronic
997120050 5:131164764-131164786 CGAGGCAGCCGGGGAACCGGCGG + Intronic
999366454 5:151026810-151026832 CGGCACAGCGGGTGAGCCGGGGG + Intronic
1002185787 5:177454307-177454329 GGGAGCGGCGGGAGACCCGGAGG + Intronic
1002212265 5:177606010-177606032 CAGTGCAGAGGGAGGACCAGAGG - Intronic
1002447984 5:179301841-179301863 GAGTGCAGCCGGAGAGCCGGTGG + Intronic
1002898411 6:1392157-1392179 GTGTGCAGCGGGAGCACCCGGGG + Intronic
1004543303 6:16572437-16572459 CGGTTCAGGGGCAGAACCGTAGG - Intronic
1007434587 6:41799842-41799864 AGGTGCAGCCGGAGAACCTGAGG + Exonic
1013800935 6:113941961-113941983 GGGTGCAGAGGGAGAAAAGGTGG + Intronic
1019268072 7:130036-130058 CGGGGCAGCCGGGGAAGCGGAGG - Intergenic
1019716775 7:2542803-2542825 CGGTGCAACGGCAGAGCCTGGGG - Intronic
1023287122 7:38631456-38631478 GGGAGGAGCGGGAGAAGCGGCGG + Exonic
1026360599 7:69598618-69598640 CGGGGCGGCGAGAGAAGCGGCGG + Intergenic
1033186540 7:139231738-139231760 CGCTGCAGCGGGAGCCCCCGCGG + Exonic
1034462293 7:151204635-151204657 TGGTGCAGCCGCAGAAGCGGCGG - Exonic
1034937702 7:155210419-155210441 CGGTGCAGGGGGAGACTAGGAGG + Intergenic
1037985521 8:23288443-23288465 CGGGGTCGCGGGAGATCCGGGGG + Intronic
1038397600 8:27258605-27258627 CTGTGGAGCTGGAGAACCAGAGG + Intergenic
1038554077 8:28494376-28494398 CGGGGCAGCGGGAGAAGGAGCGG + Intronic
1041201117 8:55452564-55452586 CGGTGCAGCGGGAGAACCGGAGG - Intronic
1050151435 9:2622314-2622336 CGGGGCACCGGGAGACCCCGAGG + Intronic
1056457243 9:86772291-86772313 CTGTGCAGTGGGAGAACTTGGGG - Intergenic
1060462222 9:123867713-123867735 GGGAGCAGGGGGAGAACTGGGGG - Intronic
1062055734 9:134468948-134468970 TGGTGCAGGGGGAGAAACTGAGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1190266056 X:48827571-48827593 TGGTGGAGCTGGAGATCCGGAGG - Intergenic