ID: 1041201354

View in Genome Browser
Species Human (GRCh38)
Location 8:55453846-55453868
Sequence CACGGACCTGTTTGATGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041201354_1041201364 20 Left 1041201354 8:55453846-55453868 CCAGCTCATCAAACAGGTCCGTG 0: 1
1: 0
2: 2
3: 3
4: 59
Right 1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG 0: 1
1: 0
2: 0
3: 43
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041201354 Original CRISPR CACGGACCTGTTTGATGAGC TGG (reversed) Intronic
905284788 1:36872181-36872203 CACGCACCTGCTTGAGGATCTGG + Exonic
921957367 1:220998533-220998555 CTGGGCCCTGTTTTATGAGCTGG - Intergenic
1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG + Intergenic
1071472554 10:85994068-85994090 CCAGGACATGTTTGATTAGCTGG - Intronic
1075977069 10:126705291-126705313 CACTGACCTGTTGGAGAAGCTGG - Intergenic
1078022292 11:7665933-7665955 CAGGGACCTGTATGACAAGCAGG + Intronic
1083491660 11:63018597-63018619 CATGGACCTGTGTTTTGAGCTGG + Intergenic
1084032271 11:66487934-66487956 CATCGACCTCTTTGAAGAGCCGG - Exonic
1084699611 11:70777789-70777811 CAGTGATGTGTTTGATGAGCTGG - Intronic
1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG + Intergenic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1095670156 12:44849216-44849238 CATGGATTTCTTTGATGAGCAGG - Intronic
1108681520 13:52784779-52784801 CATGGACCTTTTTGTGGAGCAGG + Intergenic
1110151468 13:72260006-72260028 GAAGCACCTGTTTGATGAGAGGG + Intergenic
1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG + Intergenic
1122789774 14:104179313-104179335 CAAGCACCTGTGTGAGGAGCTGG + Exonic
1143013271 17:3878084-3878106 CACAGACCTTGCTGATGAGCAGG - Intronic
1143563097 17:7706568-7706590 CACAGAACTCTTTTATGAGCGGG - Intronic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1151656040 17:75496456-75496478 CACCCACCTGTTCGATAAGCCGG - Exonic
1152231271 17:79115258-79115280 CAAGGAGCTTTGTGATGAGCAGG - Intronic
1152531708 17:80922838-80922860 CACGGACCTGCAGGCTGAGCGGG - Intronic
1162823175 19:13235664-13235686 GACGGAGAAGTTTGATGAGCCGG + Exonic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
926423878 2:12724053-12724075 CACGGACCTCTATTCTGAGCTGG - Intronic
929234423 2:39591178-39591200 CACGGCCCTTTTTTCTGAGCAGG + Intergenic
930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG + Intronic
938235061 2:129699255-129699277 CTCGGACGTCTTAGATGAGCAGG - Intergenic
947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG + Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1179490889 21:41740990-41741012 CATTGACCTGTTCGACGAGCAGG - Exonic
1179841068 21:44074192-44074214 CACAGAACTGTTAGATGAGGTGG + Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
951418528 3:22455360-22455382 CACGCAGCAGTTTGATCAGCTGG + Intergenic
961301322 3:125923975-125923997 CTCGGAGCTGTTTGAGGACCCGG - Intergenic
964655743 3:159064273-159064295 CCCTGACTGGTTTGATGAGCAGG + Intronic
969863340 4:10055049-10055071 CAGGAACCTTTTTGATGAACTGG - Intergenic
975126963 4:70793830-70793852 CAAAGTCCTGTTTGAAGAGCCGG - Exonic
976967202 4:91057838-91057860 CACAGAACTGTTTGAGGAGTTGG - Intronic
981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG + Intronic
983527086 4:168770427-168770449 TAAGGACCTGTTAAATGAGCAGG - Intronic
984621721 4:181960917-181960939 CACAGAGCTGTGTGATCAGCCGG - Intergenic
985144620 4:186882254-186882276 CAGGGTCCTGATAGATGAGCTGG + Intergenic
994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG + Intergenic
997279117 5:132627486-132627508 CTGGGACCTGATTGATGAGAAGG + Intronic
1000199726 5:158996251-158996273 CCCGGACATGTTTGTTGATCTGG - Intronic
1001097313 5:168785923-168785945 CAAGGGACTGTTTGATGGGCTGG - Exonic
1013164922 6:107581114-107581136 CAAGGACCTGTTTGATTAGTGGG + Intronic
1020269969 7:6589219-6589241 CTCTGACCTGTGTGATGTGCAGG + Exonic
1022317687 7:29260773-29260795 ACCGGACCTGTTTTATGAGGTGG + Intronic
1031634941 7:124091196-124091218 CACAGATCTGTTTGTTTAGCGGG - Intergenic
1036769888 8:11571703-11571725 CACCGAGCTGTGTGATGTGCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1047927273 8:129693798-129693820 CTGGGACCTGAATGATGAGCAGG - Intergenic
1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG + Intergenic
1056070046 9:82976897-82976919 CACGGACCTCTTTGAAGCCCAGG - Intergenic
1062354537 9:136155533-136155555 AACGGAGCAGTTTGAGGAGCAGG - Intergenic
1188185775 X:27112704-27112726 CATGGACTTCTTTGATGGGCTGG - Intergenic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1192223342 X:69212095-69212117 CTGGGACCTGTATGATGAGTAGG - Intergenic
1196123518 X:112075724-112075746 CAAGGGCCTGTTTGATGAGGGGG - Intronic
1196440081 X:115711513-115711535 CAAGGACCTTTTTGAGAAGCTGG - Intergenic