ID: 1041201364

View in Genome Browser
Species Human (GRCh38)
Location 8:55453889-55453911
Sequence CTCCAACACAAAGAGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 880}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041201354_1041201364 20 Left 1041201354 8:55453846-55453868 CCAGCTCATCAAACAGGTCCGTG 0: 1
1: 0
2: 2
3: 3
4: 59
Right 1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG 0: 1
1: 0
2: 0
3: 43
4: 880
1041201360_1041201364 2 Left 1041201360 8:55453864-55453886 CCGTGGGGCAGTACGGGACCCCA 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG 0: 1
1: 0
2: 0
3: 43
4: 880
1041201353_1041201364 23 Left 1041201353 8:55453843-55453865 CCACCAGCTCATCAAACAGGTCC 0: 1
1: 0
2: 0
3: 8
4: 196
Right 1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG 0: 1
1: 0
2: 0
3: 43
4: 880

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041201364 Original CRISPR CTCCAACACAAAGAGAGCAA AGG Intronic
900941247 1:5800022-5800044 CTCCACCAGACAGAGAGCAACGG + Intergenic
900949745 1:5851759-5851781 CACTATCACAAAGACAGCAAGGG - Intergenic
901047932 1:6409858-6409880 ATCCAACACAAAGAAAGGACAGG + Intergenic
901422030 1:9157570-9157592 CTCCAACACATAAAGATCATTGG - Intergenic
903107274 1:21093269-21093291 CCCCATCACAAAGTGGGCAAAGG + Intronic
903150065 1:21401191-21401213 TTCCTACACAAAGAGTACAATGG - Intergenic
904387740 1:30155918-30155940 CCCCAACAAAAAGTGAGCGAAGG - Intergenic
904956975 1:34292758-34292780 CTCCAACACCAAGAGGTCCAAGG - Intergenic
904986697 1:34556523-34556545 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
905006871 1:34716895-34716917 CTCCATCTCAGAGAGAGGAAGGG + Intronic
906442244 1:45858435-45858457 CCCCATCACAAAGTGGGCAAAGG - Intronic
906586222 1:46981300-46981322 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
906777450 1:48542664-48542686 CCCCATCAAAAAGTGAGCAAAGG - Intronic
907711568 1:56887526-56887548 TTCCATCAAAAAGTGAGCAAAGG - Intronic
908650024 1:66322481-66322503 CTCCATCAAAAAGTGGGCAAAGG + Intronic
909136905 1:71812719-71812741 CTCCATTAAAAAGTGAGCAAAGG - Intronic
909557046 1:76965433-76965455 CCCCATCAAAAAGAGGGCAAAGG - Intronic
909594893 1:77395595-77395617 CTCAAAGACAAAGTGAGCACAGG - Intronic
909734116 1:78934723-78934745 CTCCATCAAAAAGTGGGCAAAGG + Intronic
909849690 1:80445051-80445073 CTCAAAAACAAACAGAGCACAGG + Intergenic
909891508 1:81013547-81013569 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
910243761 1:85116852-85116874 ATCCAAAACAAAGAGAGTATTGG + Intronic
910325541 1:86002834-86002856 CTCCACCACAAAAAAAGGAAAGG + Intronic
910454740 1:87385435-87385457 CTCCACCACAAGCAGAGCCATGG - Intergenic
910780410 1:90926269-90926291 CTCCAACTCAAAGTGAACATGGG + Intronic
910952057 1:92659416-92659438 CTCCATTAAAAAGTGAGCAAAGG + Intronic
911028981 1:93466026-93466048 CTCCATCAAAAAGTGGGCAAAGG - Intronic
911561482 1:99411365-99411387 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
912595205 1:110868882-110868904 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
912600843 1:110931807-110931829 CTCCAACAAAAAGGGGGCAAAGG - Intergenic
912615392 1:111095146-111095168 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
912752353 1:112295860-112295882 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
913608217 1:120486023-120486045 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
914369974 1:147015805-147015827 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
914484720 1:148097610-148097632 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
914582985 1:149035822-149035844 CCCCATCAAAAAGAGGGCAAAGG - Intronic
915060882 1:153183541-153183563 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
915618776 1:157065180-157065202 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
915711833 1:157907149-157907171 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
915792416 1:158688371-158688393 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
915803977 1:158825136-158825158 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
915991740 1:160524479-160524501 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
916380059 1:164199781-164199803 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
916474978 1:165160717-165160739 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
916638228 1:166697127-166697149 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
916836372 1:168549857-168549879 CCCCATCACAAAGTGGGCAAAGG + Intergenic
916840585 1:168596411-168596433 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
917054335 1:170963147-170963169 CTCCATTACAAAGTGGGCAAAGG + Intronic
917159067 1:172036960-172036982 CTCCATCAAAAAGTGGGCAAAGG + Intronic
917834903 1:178933783-178933805 CTCCAGGAGAGAGAGAGCAAGGG + Intergenic
917945269 1:179963134-179963156 CTCCATTAAAAAGTGAGCAATGG - Intronic
918136046 1:181674753-181674775 CCCCAGCACAGAGAGAGCAGAGG + Intronic
918582704 1:186150048-186150070 CAGGAACACAAAGTGAGCAAAGG + Intronic
918776385 1:188636841-188636863 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
918846261 1:189618249-189618271 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
920548666 1:206839796-206839818 CTCCAACATAATGAGAGAAGAGG + Intronic
920900846 1:210109118-210109140 CTCCATCAAAAAGTGGGCAAAGG + Intronic
921629294 1:217414390-217414412 CTAAAACACAAACAGTGCAACGG - Intergenic
921698281 1:218237644-218237666 CTCCAACAAAAAGTGAGCGAAGG + Intergenic
921790775 1:219287819-219287841 CTCTATCACAAAAACAGCAATGG - Intergenic
921842635 1:219844658-219844680 CTCCATCAAAAAGTGGGCAAAGG + Intronic
922346905 1:224703941-224703963 TTCCAACTCAAAGGGAGCAACGG + Intronic
922402052 1:225269648-225269670 CTCCATCAAAAAGTGGGCAAAGG + Intronic
923222477 1:231907997-231908019 CCCCATCAAAAAGTGAGCAAAGG - Intronic
923340542 1:233003320-233003342 CCCCATCAAAAAGTGAGCAAAGG + Intronic
923686415 1:236156556-236156578 CTCCAAGACAGTGCGAGCAAGGG - Intronic
924388901 1:243529125-243529147 CTCCATTACAAAGTGGGCAAGGG - Intronic
924487504 1:244500169-244500191 CTCCATCAGAAAGTGGGCAAAGG - Intronic
924575258 1:245275152-245275174 CTCCATCAAAAAGTGGGCAAAGG - Intronic
924891138 1:248281426-248281448 CTCCAATAAAAAGTGGGCAAAGG - Intergenic
1062765509 10:60395-60417 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1063032938 10:2254249-2254271 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1063760614 10:9070932-9070954 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1064616674 10:17165689-17165711 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1065647284 10:27848720-27848742 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1065848865 10:29769924-29769946 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1066001397 10:31107205-31107227 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1066029577 10:31406518-31406540 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1066051319 10:31638466-31638488 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1066608640 10:37210789-37210811 CCCCATCATAAAGTGAGCAAAGG - Intronic
1067149839 10:43722000-43722022 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1067710107 10:48642907-48642929 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1068185326 10:53577884-53577906 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
1068449468 10:57166784-57166806 CTCTATCACAAGGACAGCAAGGG + Intergenic
1068475445 10:57518034-57518056 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1068525993 10:58130376-58130398 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1068623279 10:59210244-59210266 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1068821437 10:61380845-61380867 CCCCATCAAAAAGAGAGCAAAGG + Intergenic
1069194849 10:65538490-65538512 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
1069343828 10:67443618-67443640 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1070591188 10:77802255-77802277 CTACTACACAAAGAGAGCCAGGG + Intronic
1070726207 10:78792928-78792950 CTTGAACACAAAGAGATCAATGG + Intergenic
1070908643 10:80097970-80097992 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1070937228 10:80309344-80309366 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1071071748 10:81702221-81702243 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
1071076767 10:81764037-81764059 CTCCATCAAAAAGTGAGCAAAGG - Intergenic
1071210661 10:83338192-83338214 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1071272942 10:84025525-84025547 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1071460596 10:85890611-85890633 CTCCAGCATAGACAGAGCAATGG - Intronic
1071848693 10:89546352-89546374 CACCATCAAAAAGTGAGCAAAGG + Intronic
1071946058 10:90646242-90646264 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1072024291 10:91438900-91438922 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1072812411 10:98472941-98472963 CCCCAACAGAAAAATAGCAAAGG + Intronic
1072817221 10:98521302-98521324 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1072987297 10:100152135-100152157 ATCCAAAACAAAGAGAGCACAGG - Exonic
1073866248 10:107807736-107807758 CTCCAACAGTAAGAGAACACTGG + Intergenic
1074016285 10:109537441-109537463 CCTCATCAAAAAGAGAGCAAAGG - Intergenic
1074216223 10:111386946-111386968 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1074930977 10:118125803-118125825 CCCCAATACAAAGTGGGCAAAGG - Intergenic
1074961284 10:118448268-118448290 CTCCTCCACGAAGAAAGCAAGGG + Intergenic
1075386361 10:122058156-122058178 CTACACCACAAAGTGAGCATGGG + Intronic
1075983439 10:126761893-126761915 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1076455193 10:130587844-130587866 CTTCCAAGCAAAGAGAGCAAGGG - Intergenic
1076580424 10:131505384-131505406 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1077002523 11:331396-331418 CTCCAAGAAAAAGAGACTAAGGG + Intergenic
1077858030 11:6148822-6148844 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1078649902 11:13180238-13180260 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1078812555 11:14782931-14782953 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1078841459 11:15079401-15079423 CTCCAACAAATAAACAGCAAGGG - Intronic
1079086594 11:17450192-17450214 CTCCAAAAGAAAGAAAGAAAGGG + Intronic
1079296488 11:19239749-19239771 CTCAGACATAAAGAGAGAAAAGG + Intronic
1079675361 11:23219925-23219947 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1079707095 11:23634540-23634562 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1080315976 11:30949173-30949195 CCCCACCAAAAAGTGAGCAAAGG + Intronic
1080482128 11:32662507-32662529 CCCCATCACAAAGTGGGCAAAGG - Intronic
1080904432 11:36526904-36526926 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1080914661 11:36644167-36644189 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1081037306 11:38164829-38164851 CCCCATCAGAAAGTGAGCAAAGG - Intergenic
1081309213 11:41550094-41550116 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1081459186 11:43255556-43255578 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
1082885165 11:58074429-58074451 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1082945568 11:58755151-58755173 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1083229325 11:61305617-61305639 CTCCAACAGAAAGAGTGAAGCGG + Intronic
1083970600 11:66071504-66071526 TTCCAACAGACAGAGAGCAATGG - Intronic
1084986889 11:72882140-72882162 CTCAAAAAAAAAGAGAGCAGAGG + Intronic
1085066891 11:73504323-73504345 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1085495896 11:76969112-76969134 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1086388930 11:86340574-86340596 CCCCATCAAAAAGAGGGCAAAGG - Intronic
1086555779 11:88109686-88109708 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1086585100 11:88442386-88442408 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1086664687 11:89465802-89465824 CCCCATCATAAAGTGAGCAAAGG - Intronic
1086792503 11:91060234-91060256 CTCCATCACAAAGTGGGCCAAGG + Intergenic
1086906664 11:92426206-92426228 CCCCAACAAAAAGTGGGCAAAGG - Intronic
1087002957 11:93439904-93439926 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1087941942 11:104108369-104108391 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1088690666 11:112324108-112324130 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1090166401 11:124553341-124553363 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1090613797 11:128496530-128496552 GACCAACACAAATAGAGAAATGG + Intronic
1091052782 11:132388721-132388743 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1091063221 11:132484236-132484258 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1091293987 11:134459658-134459680 CTCCCACACAAAGCGGGCCAGGG + Intergenic
1091709508 12:2728345-2728367 CTCCAATAAAAAGTGGGCAAAGG - Intergenic
1091834170 12:3573176-3573198 CTTAAACACAAAGAGAAAAAAGG - Intronic
1092326165 12:7533796-7533818 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1092962774 12:13611771-13611793 CTCAAAGACAAAGACAGCCACGG + Exonic
1093106772 12:15096504-15096526 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1093120572 12:15266529-15266551 CTCTATCACAAAAACAGCAAGGG + Intronic
1093241759 12:16685278-16685300 CACCAAAACAAAGACAACAAAGG - Intergenic
1093270235 12:17051377-17051399 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1093835158 12:23820250-23820272 CTCCACCAAAAAGTGGGCAAAGG - Intronic
1094274445 12:28655301-28655323 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1094323902 12:29215861-29215883 CTCAAACTCAATGAGAGTAAGGG - Intronic
1094398660 12:30036915-30036937 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1094464205 12:30734389-30734411 CATCAAAACAAAAAGAGCAATGG + Intronic
1094519319 12:31168249-31168271 CCCCAACAAAAAGTGCGCAAAGG + Intergenic
1095032961 12:37318698-37318720 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1095505778 12:42896664-42896686 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1095655062 12:44659517-44659539 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1095779282 12:46041244-46041266 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1095914612 12:47464606-47464628 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1096569881 12:52516175-52516197 CTCCAACAGAAAGTAGGCAATGG + Intronic
1096959664 12:55565656-55565678 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1097414664 12:59300208-59300230 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1097452189 12:59750380-59750402 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1097531677 12:60809396-60809418 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1097543734 12:60972890-60972912 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1098410960 12:70183175-70183197 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1098615284 12:72515460-72515482 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1098717329 12:73847017-73847039 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1099045140 12:77707884-77707906 CTCCATCAAAAAGTGAGCAAAGG - Intergenic
1099200714 12:79673398-79673420 TACCAATACAAAGAGAGAAAAGG + Intronic
1099261753 12:80391109-80391131 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1099618250 12:84966701-84966723 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1099618446 12:84970568-84970590 CTAAAAACCAAAGAGAGCAAGGG - Intergenic
1099631334 12:85148972-85148994 CCCCATCAAAAAGCGAGCAAAGG - Intronic
1099702174 12:86099521-86099543 CTCCATCAGAAAGTGAGCAAAGG + Intronic
1100066001 12:90645943-90645965 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1100417614 12:94394790-94394812 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1100463918 12:94828122-94828144 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1100494587 12:95112597-95112619 CTCAAACAAAAAAAGAACAAGGG + Intronic
1100692372 12:97052051-97052073 CTCAAACAGAAAGAGAGAGATGG + Intergenic
1100861320 12:98810314-98810336 CTCCAACCCAAAGTGAACATAGG + Intronic
1100982855 12:100176081-100176103 TTCCAACAGAAAGTGGGCAATGG + Intergenic
1101072432 12:101089916-101089938 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1101118880 12:101558414-101558436 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1101231269 12:102743922-102743944 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1101296608 12:103430281-103430303 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1102153730 12:110707337-110707359 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1102323977 12:111962980-111963002 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1102515715 12:113445062-113445084 CGGCCACACAAACAGAGCAAAGG - Intergenic
1102731304 12:115113088-115113110 CTCCATCAAAAAGTGGGCAAGGG + Intergenic
1103100216 12:118167870-118167892 TTCCATGACACAGAGAGCAAGGG - Intronic
1105871214 13:24507339-24507361 ATCCAACACACACAGGGCAAAGG - Intronic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106783196 13:33080464-33080486 CTCCATCACCAGGAGCGCAATGG + Intergenic
1106938554 13:34750687-34750709 CTCAAAGACAGAGAGAGAAAGGG + Intergenic
1107278294 13:38703083-38703105 CTCAAACACAAAGAGACTACCGG + Intronic
1107675912 13:42796719-42796741 CTCCTACTAAAAGAGACCAAGGG + Intergenic
1108188546 13:47913264-47913286 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1108551150 13:51546144-51546166 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1108958117 13:56186826-56186848 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1109394982 13:61745066-61745088 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1109615886 13:64833333-64833355 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1109641036 13:65192027-65192049 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1109643452 13:65221951-65221973 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1110070992 13:71177599-71177621 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1110258500 13:73458652-73458674 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1110292689 13:73825436-73825458 CTATAACACCAAGAGAGCATAGG + Intronic
1110541421 13:76710516-76710538 CTCCAACAAAAACAAAACAAGGG - Intergenic
1110628359 13:77677232-77677254 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1110789958 13:79576689-79576711 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1111087954 13:83401142-83401164 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1111646543 13:91038740-91038762 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1111786662 13:92795680-92795702 CCCCATCACAAAGTGGGCAAAGG + Intronic
1111831995 13:93341568-93341590 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1111892694 13:94103708-94103730 CCCCATCACAAAGTGGGCAAAGG - Intronic
1111998639 13:95189883-95189905 ATCCAGCACAAAGGGAGGAAGGG + Intronic
1112113350 13:96327001-96327023 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1112937502 13:104819712-104819734 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1112948238 13:104958025-104958047 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1113384094 13:109832321-109832343 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1113929028 13:113956784-113956806 CTCCACCAGGAAGAGGGCAAAGG - Intergenic
1114133051 14:19815495-19815517 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1114342204 14:21756589-21756611 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1114374408 14:22128579-22128601 CCCCAACAAAAAGTGAGCAAAGG - Intergenic
1114944720 14:27665414-27665436 CCCAAACAAAAAGTGAGCAAAGG - Intergenic
1115043455 14:28959431-28959453 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1115107680 14:29780457-29780479 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1115362766 14:32522507-32522529 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1115801648 14:37000729-37000751 CACCATCACAAAAATAGCAAGGG - Intronic
1116140787 14:40991818-40991840 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1116415848 14:44676050-44676072 CCCCATCACAAAGTGCGCAAAGG + Intergenic
1116416734 14:44686491-44686513 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1116554348 14:46284456-46284478 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1116567874 14:46473968-46473990 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1117082132 14:52162997-52163019 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1117296095 14:54380574-54380596 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1118803976 14:69218357-69218379 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1119945693 14:78691537-78691559 ATCCAGGACAAAGAGAGCCAAGG - Intronic
1120065233 14:80032866-80032888 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1120126103 14:80745202-80745224 CTGCAAGAGAGAGAGAGCAAAGG - Intronic
1120271367 14:82317765-82317787 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1120742450 14:88123028-88123050 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1121161773 14:91749704-91749726 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1121861557 14:97323706-97323728 CACCATCAAAAAGTGAGCAAAGG + Intergenic
1121905984 14:97745266-97745288 CTCCATCAAAAAGAGGGCAAAGG + Intergenic
1122239067 14:100349810-100349832 CTCCCACTCAAAGAGGGCGATGG + Intronic
1123140650 14:106074069-106074091 CTCTAACACAAGAAGAGCAAAGG - Intergenic
1123387079 15:19823635-19823657 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1125503076 15:40251716-40251738 GCCCAAGACAAGGAGAGCAAAGG + Exonic
1125682769 15:41543071-41543093 CTACATCACAAAGAGAGCCAGGG + Intronic
1125837848 15:42769427-42769449 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1126210956 15:46099625-46099647 CTCTAACACAAGGACAGCACTGG - Intergenic
1126444936 15:48731851-48731873 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1127095133 15:55505086-55505108 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1127136818 15:55932841-55932863 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1127317367 15:57809963-57809985 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1128592969 15:68918724-68918746 CCCCATCAAAAAGTGAGCAAGGG + Intronic
1128782678 15:70373063-70373085 CCCCATCAAAAAGTGAGCAAGGG + Intergenic
1129029864 15:72610283-72610305 GTCCAGAACAAAGAGAGCAAGGG + Intergenic
1129636251 15:77321482-77321504 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1129963874 15:79715655-79715677 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1131027604 15:89157962-89157984 ATCAAACACAAAGAAAACAATGG + Intronic
1131690593 15:94823385-94823407 CCCCTTCACAAAGAGAGAAACGG + Intergenic
1131811153 15:96174538-96174560 CTCCTACAGATACAGAGCAATGG - Intergenic
1132400888 15:101504534-101504556 CTCCAAGACAGGAAGAGCAAAGG + Intronic
1132423809 15:101696967-101696989 CTCCACCCCAAAGTGAACAAGGG + Intronic
1133917421 16:10121603-10121625 CTCCAACACAAGCAAAGCAAAGG + Intronic
1134393410 16:13840639-13840661 CTCAACCCCAAAGAGAGCATGGG + Intergenic
1134424131 16:14123113-14123135 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1134557922 16:15182186-15182208 CTCCACCACACAAAGAGGAATGG - Intergenic
1134625099 16:15717853-15717875 CTCCAGGACAGAGAAAGCAAGGG - Intronic
1134794220 16:17019722-17019744 CCCCAACACAAAGAGAAGAGAGG - Intergenic
1134918458 16:18093789-18093811 CTCCACCACACAAAGAGGAATGG - Intergenic
1135297536 16:21295494-21295516 CCCCATCAAAAAGTGAGCAAGGG - Intronic
1136083359 16:27867569-27867591 CTCTGACACACAGTGAGCAAGGG - Intronic
1136645858 16:31614221-31614243 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1137889849 16:52147770-52147792 CACCATCAAAAAGTGAGCAAAGG - Intergenic
1138599823 16:58047722-58047744 TTTCAACACAAAGAGAGGAAGGG - Intergenic
1138702574 16:58879273-58879295 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
1138769767 16:59649598-59649620 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1138928203 16:61617807-61617829 CTCCATCACAAAGTGAACATGGG + Intergenic
1140147894 16:72329695-72329717 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1140952189 16:79829234-79829256 CAACAACAGAAAGAGAACAAGGG + Intergenic
1142854547 17:2722581-2722603 CTCCAACAAATGGAGAGAAAGGG + Intergenic
1143604433 17:7973819-7973841 ATCCAAAACAGAAAGAGCAAAGG + Intergenic
1144277700 17:13689970-13689992 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1146690415 17:34871138-34871160 CTCCAAAACAGAGAAAACAAAGG - Intergenic
1149178521 17:53904597-53904619 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1150946329 17:69750232-69750254 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1151517266 17:74604664-74604686 CTCCTACCCAAAGCCAGCAAAGG + Intergenic
1153312889 18:3694706-3694728 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1153391126 18:4560803-4560825 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1154222447 18:12468412-12468434 CTCCAAAACATGGAGAGCAGTGG + Intronic
1155034707 18:22016300-22016322 CTCCAAAAAAAAAAGAACAAAGG - Intergenic
1155351029 18:24906400-24906422 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1156143223 18:34141999-34142021 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1156309160 18:35906968-35906990 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1156832218 18:41505439-41505461 TGCCAACACGAAGAGAGTAAGGG - Intergenic
1156935212 18:42696685-42696707 CTGCAATACAAAGACTGCAAAGG - Intergenic
1157037211 18:43989343-43989365 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1157219162 18:45813084-45813106 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1157228046 18:45885858-45885880 CTCCAACAGAAAGTGTACAAAGG + Intronic
1158084469 18:53634623-53634645 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1158413483 18:57229170-57229192 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1159143940 18:64429568-64429590 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1159155028 18:64572198-64572220 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1159463516 18:68750100-68750122 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1162863900 19:13529158-13529180 CTCCAACAGAAATACAACAAGGG - Intronic
1163438163 19:17307809-17307831 CTCCAACAGCAACAGAGCAGAGG - Intronic
1164110787 19:22156343-22156365 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1164133933 19:22394004-22394026 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1164163305 19:22645345-22645367 TTCCATCAAAAAGTGAGCAAAGG - Intronic
1164164873 19:22662756-22662778 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1164352978 19:27375415-27375437 CCCCATCAAAAAGGGAGCAAAGG - Intergenic
1164819366 19:31233751-31233773 CTTCAAAACAACGTGAGCAAAGG + Intergenic
1165870647 19:38970506-38970528 CTCACACACGAAGAGAGAAAGGG - Intronic
1166872281 19:45877961-45877983 CACCAACACAAACCCAGCAATGG - Intergenic
1168513157 19:56989486-56989508 CTCCCACACAAACAGAGCGCAGG - Intergenic
925477164 2:4230214-4230236 CTGGAACACAAGGAGAGCAGGGG - Intergenic
926074214 2:9927693-9927715 CCCCATCAAAAAGTGAGCAAAGG - Intronic
926233265 2:11020748-11020770 CTCCATCACAAAGGGAACATGGG + Intergenic
926260059 2:11251832-11251854 CTCCATCAAAAAGTGGGCAAAGG + Intronic
926392805 2:12411297-12411319 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
927028405 2:19094548-19094570 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
928268153 2:29830206-29830228 GTCCTTCACAAAGAGACCAATGG + Intronic
928480562 2:31678915-31678937 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
928878183 2:36065838-36065860 CTCCATCAAAAAGCGGGCAAAGG + Intergenic
929076096 2:38080087-38080109 CTCCAACCCAAAGAAACCAGTGG - Intronic
929280715 2:40075135-40075157 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
929355354 2:41016769-41016791 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
930150421 2:48053705-48053727 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
930242383 2:48949296-48949318 CTCCAACTCACATAGAGAAAAGG + Intergenic
930981490 2:57531325-57531347 CTCCATTACAAAGTGGGCAAAGG + Intergenic
930986254 2:57591594-57591616 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
930988073 2:57614005-57614027 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
931112231 2:59123707-59123729 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
931352389 2:61503255-61503277 CTCCAAAAAAAAGAAAGAAAAGG - Intronic
931971722 2:67594210-67594232 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
932181110 2:69647016-69647038 CTCCACCCCAAAGAGAACATAGG + Intronic
932464988 2:71914554-71914576 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
932482694 2:72056397-72056419 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
932794895 2:74685878-74685900 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
932847267 2:75148543-75148565 CTCCATCAAAAAGTGGGCAAAGG - Intronic
933164784 2:79064064-79064086 TCCCATCACTAAGAGAGCAAGGG - Intergenic
933197529 2:79409121-79409143 CCCCAACAAAAAGTGGGCAAAGG - Intronic
933214439 2:79612373-79612395 CTCCAACAAAAACAAAGCCATGG - Intronic
933323895 2:80811792-80811814 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
933602018 2:84342517-84342539 CCCCATCACAAAGTGGGCAAAGG - Intergenic
933607790 2:84402178-84402200 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
933653441 2:84867754-84867776 CCCCATCACAAAGTGGGCAAAGG + Intronic
935075621 2:99740635-99740657 CCCCATCAAAAAGTGAGCAAAGG - Intronic
936533718 2:113294560-113294582 CTCCAATAGAAACAGAGCAGGGG - Intergenic
936827832 2:116603359-116603381 CCCCATCAGAAAGTGAGCAAAGG + Intergenic
936848539 2:116868137-116868159 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
937148373 2:119667626-119667648 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
937328621 2:121007619-121007641 CTCCACCACTCAGAGGGCAATGG - Intergenic
937585459 2:123542619-123542641 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
937586133 2:123553012-123553034 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
938254255 2:129842527-129842549 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
938272975 2:129992027-129992049 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
938633133 2:133191092-133191114 CCCCATCAAAAAGTGAGCAAAGG + Intronic
938633989 2:133202708-133202730 CCCCATCAAAAAGTGAGCAAAGG + Intronic
938862679 2:135386160-135386182 CTCCATCAAAAAGTGGGCAAAGG + Intronic
938874711 2:135520386-135520408 CTCCACCTCAAAGAGAAAAAAGG + Intronic
939358674 2:141139519-141139541 ATCCTACACAAAAAGGGCAAAGG + Intronic
939364794 2:141217902-141217924 CTCCATTAAAAAGTGAGCAAAGG + Intronic
939380239 2:141425742-141425764 CTCCATCAAAAAGTGGGCAAAGG - Intronic
939710028 2:145506129-145506151 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
939941331 2:148354923-148354945 GTCCATCAAAAAGTGAGCAAAGG - Intronic
940257690 2:151748650-151748672 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
940504921 2:154541168-154541190 CTCCCACACAAAAAGAGCACAGG + Intergenic
940525153 2:154804694-154804716 CTCCAAGACAGAGAGAGTTAAGG + Intronic
940551140 2:155158330-155158352 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
940603080 2:155885522-155885544 CCCCATCACAAAGTGGGCAAAGG + Intergenic
940764015 2:157770290-157770312 CACCAAAACGGAGAGAGCAAAGG + Intronic
941193038 2:162410767-162410789 CTCCAATAAAAAGTGGGCAAAGG + Intronic
941496064 2:166205832-166205854 CTCCATCAAAAAGTGGGCAAAGG + Intronic
941518239 2:166506416-166506438 CCCCATCAAAAAGTGAGCAATGG - Intergenic
942407751 2:175673959-175673981 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
942467023 2:176218973-176218995 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
942474684 2:176306733-176306755 CCCCATCAAAAAGTGAGCAAAGG - Intronic
943097604 2:183449130-183449152 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
943429322 2:187778147-187778169 AGCCAACATAAAGTGAGCAAAGG + Intergenic
943483590 2:188453637-188453659 TTCCAAGATACAGAGAGCAATGG + Intronic
943492064 2:188566948-188566970 CCCCATCACAAAGCGGGCAAAGG + Intronic
943546358 2:189284531-189284553 CTCCATCACAAGAACAGCAAGGG + Intergenic
943864108 2:192906394-192906416 CCCCATCACAAAGTGGGCAAAGG - Intergenic
943980537 2:194544151-194544173 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
944025223 2:195157374-195157396 CTCCATCAAAAAGCGGGCAAAGG + Intergenic
944305974 2:198180418-198180440 CTTCAACACAAAGAGATCACTGG + Intronic
944918150 2:204382255-204382277 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
944935031 2:204559357-204559379 CCCCATCACAAAGTGGGCAAAGG + Intronic
944950843 2:204746803-204746825 CCCCATCACAAAGTGGGCAAAGG - Intronic
945309643 2:208296374-208296396 CTTCAACAGAAAGACATCAAAGG + Intronic
945355698 2:208836880-208836902 CCCCAACAAAAAGTGGGCAAAGG + Intronic
945366722 2:208963927-208963949 CTCCATGAAAAAGTGAGCAAAGG + Intergenic
945508090 2:210666148-210666170 CCCCATCAAAAAGTGAGCAAAGG - Intronic
945735961 2:213600800-213600822 CTACAACACATAGCGAGAAAAGG - Intronic
945945704 2:215993732-215993754 CTCCATCAAAAAGTGAGCAAAGG + Intronic
947245969 2:228048822-228048844 CCCCAATAAAAAGAGGGCAAAGG - Intronic
949038169 2:241829060-241829082 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1170088322 20:12561948-12561970 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1170242501 20:14183858-14183880 CCCCATTACAAAGAGGGCAAAGG - Intronic
1170694942 20:18649622-18649644 CTTGAACACAGAAAGAGCAATGG - Intronic
1170832364 20:19853705-19853727 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1171156013 20:22874998-22875020 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1171823424 20:29875200-29875222 CTGCTACAGAAGGAGAGCAAGGG - Intergenic
1171896677 20:30815127-30815149 CTGCTACAGAAGGAGAGCAAGGG + Intergenic
1172467140 20:35164210-35164232 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
1173366289 20:42388444-42388466 CCCCATCAAAAAGTGAGCAAGGG + Intronic
1174724070 20:52842951-52842973 CTCCAAAAGAACGAGAACAACGG - Intergenic
1174999679 20:55613062-55613084 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1176815062 21:13591952-13591974 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1177029293 21:15962484-15962506 CTATAACACAAAGAGGGCAAAGG - Intergenic
1177541476 21:22498800-22498822 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1177942883 21:27432762-27432784 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1177949818 21:27521090-27521112 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1178319534 21:31594844-31594866 CTCCAACACACACTGAGGAAAGG + Intergenic
1183534080 22:38385416-38385438 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1184988102 22:48149318-48149340 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1185371953 22:50465040-50465062 CTCTGACACAAAGCCAGCAAAGG + Exonic
949303880 3:2617306-2617328 CCCCATCAAAAAGTGAGCAAAGG + Intronic
949406980 3:3724547-3724569 CCCCAACAAAAAGTGGGCAAAGG + Intronic
949847999 3:8391583-8391605 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
950269591 3:11603539-11603561 CTCCTCCACAAAGAGAGAAGAGG + Intronic
950720080 3:14876284-14876306 CTGTCACACAAAGACAGCAAAGG - Intronic
951269006 3:20602747-20602769 CCCCAGCACAAAGACAACAAGGG + Intergenic
951378256 3:21950377-21950399 CTCCATCAAAAAGTGGGCAACGG - Intronic
951684972 3:25333846-25333868 CCCCATCACAAAGTGGGCAAAGG + Intronic
951759066 3:26125289-26125311 CCCCATCACAAAGTGGGCAAAGG - Intergenic
952128973 3:30337061-30337083 CCCCATCACAAAGTGGGCAAAGG - Intergenic
952603148 3:35109092-35109114 CCCCATCACAAAGTGGGCAAAGG + Intergenic
952986131 3:38785796-38785818 CTCCATCAAAAAGTGGGCAAAGG + Intronic
953300844 3:41774391-41774413 CCCCATCACAAAGTGGGCAAAGG + Intronic
953512488 3:43556672-43556694 GTCCAACAAAAAGAGAGAATAGG - Intronic
953929524 3:46999017-46999039 CTCCAACAGAAAGACAGCCAAGG - Exonic
954490122 3:50896322-50896344 CTCCATCAAAAAGTGGGCAAAGG - Intronic
954490957 3:50904585-50904607 CCCCATCACAAAGTGGGCAAAGG - Intronic
955049322 3:55393982-55394004 CCCCAACAAAAAGTGAACAAAGG + Intergenic
955172151 3:56577244-56577266 CTCCATCAAAAAGTGGGCAAAGG - Intronic
955630739 3:60971537-60971559 CTCCAATGCATAGATAGCAAGGG - Intronic
955750021 3:62177961-62177983 CTCCAATAAAAACAGAGAAAAGG - Intronic
956234460 3:67053219-67053241 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
956318003 3:67961158-67961180 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
956569335 3:70676490-70676512 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
956570743 3:70691571-70691593 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
956716652 3:72085646-72085668 CTCCATCACAAGGCGAGCCAGGG - Intergenic
956861983 3:73333669-73333691 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
957465585 3:80586205-80586227 CTCCAACAGAGAGACAGCGAGGG + Intergenic
957597054 3:82279986-82280008 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
958022012 3:88009007-88009029 CCCCACCAAAAAGTGAGCAAAGG + Intergenic
958198720 3:90279438-90279460 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
958409773 3:93802212-93802234 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
958464229 3:94438880-94438902 CTCCATCAAAAAGGGGGCAAAGG + Intergenic
958585955 3:96087788-96087810 ATCCTAAGCAAAGAGAGCAATGG + Intergenic
958626146 3:96626640-96626662 CCCCATCACAAAGTGGGCAAAGG + Intergenic
958770286 3:98417830-98417852 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
958849405 3:99305821-99305843 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
959002956 3:100985935-100985957 ATCCACCACAAAGAGCTCAATGG - Intronic
959213390 3:103418286-103418308 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
959264507 3:104120293-104120315 CCCCATCACAAAGTGGGCAAAGG - Intergenic
960106627 3:113804689-113804711 CACCTACACAAAGATAACAAGGG + Intronic
960478884 3:118163569-118163591 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
960783504 3:121346774-121346796 CTCCATCAAAAAGTGGGCAAAGG - Intronic
960831892 3:121858491-121858513 CTCCATCAAAAAGTGGGCAAAGG - Intronic
960920134 3:122738184-122738206 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
961166689 3:124768460-124768482 GTCCAACACAGAGAAAGCCATGG - Intronic
961341160 3:126220958-126220980 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
961875787 3:130022512-130022534 GTCCAAGACACAGAGAGCCACGG - Intergenic
962389125 3:134957104-134957126 CTCCAAGCCCAAGAGAGCCATGG + Intronic
962438311 3:135386992-135387014 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
962459180 3:135592870-135592892 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
962656451 3:137548945-137548967 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
962879829 3:139566184-139566206 CTCCATCAGAAAGTGGGCAAAGG - Intronic
963531983 3:146482394-146482416 CCCCATCAAAAAGTGAGCAAAGG + Intronic
963532054 3:146483208-146483230 CCCCATCAAAAAGTGAGCAAAGG + Intronic
963576418 3:147066136-147066158 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
963813106 3:149799376-149799398 CCCCATCACAAAGCGGGCAAAGG + Intronic
963813513 3:149804023-149804045 CCCCATCACAAAGTGGGCAAAGG - Intronic
963983964 3:151570557-151570579 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
964086906 3:152830072-152830094 GTCAAAGACAAAGACAGCAAAGG + Intergenic
964393390 3:156220540-156220562 CTCCATCAAAAAGTGGGCAAAGG - Intronic
964680784 3:159336166-159336188 CTCCATCAAAAAGTGAGCGAAGG - Intronic
964964748 3:162478270-162478292 ACCCATCACAAAGTGAGCAAAGG + Intergenic
965059169 3:163761504-163761526 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
965332986 3:167400521-167400543 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
966078441 3:175968210-175968232 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
966187043 3:177236753-177236775 CTTCTACAGAAAGAGAGAAATGG - Intergenic
967344938 3:188444803-188444825 CTCCATCAAAAAGTGGGCAAAGG + Intronic
967757321 3:193184714-193184736 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
967932236 3:194698491-194698513 ATCCAACATAAAGAGAGGCATGG + Intergenic
968104058 3:195989337-195989359 CTCAGACACTCAGAGAGCAAGGG + Intergenic
968302360 3:197626926-197626948 CTCAGACACTCAGAGAGCAAGGG + Intergenic
970012542 4:11475535-11475557 ATCCAACATAGAGAGAGAAAAGG - Intergenic
970288675 4:14548266-14548288 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
970666029 4:18338083-18338105 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
970995417 4:22261977-22261999 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
971159200 4:24116114-24116136 CACAAACACAATGAAAGCAAGGG - Intergenic
971493706 4:27241280-27241302 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
972212841 4:36859545-36859567 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
972902814 4:43705708-43705730 CTCCATCACAAGAACAGCAATGG - Intergenic
973013412 4:45106070-45106092 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
973116320 4:46464544-46464566 CCCCAACAAAAAGTGGGCAAAGG - Intronic
973722549 4:53739955-53739977 CTCCATCAAAAAGTGGGCAAAGG + Intronic
974296821 4:60011285-60011307 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
974321611 4:60356930-60356952 CTCCATCAAAAAGTGAGCTAAGG + Intergenic
974470673 4:62314547-62314569 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
974583999 4:63845887-63845909 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
974670749 4:65026791-65026813 CCCCATCACAAAGTGAGCAAAGG - Intergenic
974772692 4:66436367-66436389 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
974827009 4:67144238-67144260 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
974834190 4:67227487-67227509 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
974935145 4:68402867-68402889 TTCCAACACAATGATAGGAAGGG - Intergenic
975296982 4:72746163-72746185 CTCCACCAAAAAGTGAGCAAAGG - Intergenic
975492925 4:75008083-75008105 TTCCAATACAAAGATAGCCAGGG - Intronic
975500091 4:75075049-75075071 CCCCATCACAAAGTGAGCGAAGG - Intergenic
975537179 4:75463184-75463206 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
975904329 4:79191503-79191525 CTCCATTACAAAGTGGGCAAAGG - Intergenic
975931306 4:79526552-79526574 CTCCAACATAAACTCAGCAAGGG - Intergenic
976031793 4:80764266-80764288 CTCCATCAAAAAGTGGGCAAAGG + Intronic
976131549 4:81890090-81890112 CTCCATCAAAAAGTGGGCAAAGG + Intronic
976371259 4:84291084-84291106 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
976441465 4:85080590-85080612 CTCCATATCATAGAGAGCAAAGG + Intergenic
976446777 4:85139203-85139225 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
976483394 4:85570860-85570882 CTCCAACTCAAAGCAAGCAATGG - Intronic
976955803 4:90897934-90897956 CTCCATCAAAAAGTGGGCAAAGG - Intronic
977382311 4:96291351-96291373 CTCCACCTCAAAGCGAGCATTGG - Intergenic
977398393 4:96500118-96500140 CCCCATCACAAAGTGGGCAAAGG - Intergenic
977523362 4:98113559-98113581 CTGCAACACAAAGAGCAGAAAGG + Intronic
977632455 4:99258278-99258300 CCCCATCACAAAGTGGGCAAGGG - Intergenic
977680502 4:99793474-99793496 CCCCATCACAAAGTGGGCAAAGG - Intergenic
977774915 4:100905750-100905772 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
977983091 4:103349065-103349087 ATCACACACAAAAAGAGCAAGGG - Intergenic
978188459 4:105885352-105885374 CTCCATCAAAAAGTGGGCAAAGG + Intronic
978258525 4:106721732-106721754 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
978919862 4:114170247-114170269 CACCATCACAAAAACAGCAAGGG - Intergenic
979022386 4:115519903-115519925 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
979070852 4:116204678-116204700 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
979117759 4:116849224-116849246 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
979130463 4:117038313-117038335 CCCCATCACAAAGTGGGCAAAGG + Intergenic
979458219 4:120950371-120950393 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
979492592 4:121345312-121345334 CTACAACAGAAAGCGACCAAGGG - Intronic
979520487 4:121660825-121660847 CCCCATCAAAAAGCGAGCAAAGG - Intergenic
979529525 4:121754355-121754377 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
979642730 4:123028332-123028354 CTCTAAAACAATGATAGCAAAGG + Exonic
980173323 4:129315435-129315457 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
980419771 4:132544794-132544816 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
980587420 4:134834965-134834987 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
980959966 4:139465211-139465233 CCCCATCAAAAAGTGAGCAAAGG - Intronic
981108793 4:140911857-140911879 CTCAAACACACACAGAGCACAGG + Intronic
981560482 4:146043084-146043106 CTCCATCAAAAAGTGAACAAAGG - Intergenic
981602068 4:146501082-146501104 CTCCAACATTAAGAGGTCAAGGG - Intronic
981630199 4:146809581-146809603 CTCCATCAAAAAGTGGGCAAAGG + Intronic
981809898 4:148761917-148761939 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
982662532 4:158224231-158224253 CTCCATCAAAAAGTGGGCAAAGG - Intronic
982846645 4:160260928-160260950 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
983271850 4:165571494-165571516 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
983770462 4:171542222-171542244 CTCCAACACAAAGTGAATATGGG + Intergenic
984216318 4:176916652-176916674 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
984283640 4:177702588-177702610 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
984548334 4:181132669-181132691 CTCCAGCCCAAAGAGAGCTCTGG + Intergenic
985356675 4:189127097-189127119 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
985524284 5:394290-394312 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524293 5:394328-394350 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524302 5:394366-394388 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524311 5:394404-394426 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524320 5:394442-394464 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524329 5:394480-394502 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524338 5:394518-394540 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524347 5:394556-394578 CTCCAGCACACAGGGAGGAAAGG - Intronic
985524356 5:394594-394616 CTCCAGCACACAGGGAGGAAAGG - Intronic
986138093 5:5001566-5001588 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
986253065 5:6078915-6078937 CTCCACCCCAAAGTGAGCATGGG + Intergenic
986519603 5:8600154-8600176 CTTCATCACAAAAACAGCAAGGG - Intergenic
986807871 5:11325980-11326002 CTCCACCACAAAGTGAACATGGG + Intronic
987529574 5:19100409-19100431 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
988059958 5:26153821-26153843 CACCATCAAAAAGTGAGCAATGG + Intergenic
988406778 5:30834247-30834269 CTCCATTAAAAAGTGAGCAAAGG + Intergenic
988440933 5:31231854-31231876 CTCTAACATAAAGAGATAAAAGG + Intronic
988646088 5:33096720-33096742 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
989254562 5:39352177-39352199 CTCCATCACAAGAACAGCAAGGG + Intronic
989311251 5:40021324-40021346 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
989526967 5:42464826-42464848 CTCCACTACAAAGAAAGGAAGGG + Intronic
989583950 5:43059742-43059764 CCCCATCACAAAGTGGGCAAAGG + Intergenic
989839629 5:46046540-46046562 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
989951779 5:50307920-50307942 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
989955024 5:50348334-50348356 CCCCATCAAAAAGTGAGCAATGG - Intergenic
990047821 5:51456519-51456541 ATACATCACAAAAAGAGCAATGG - Intergenic
990244345 5:53849203-53849225 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
990691794 5:58372401-58372423 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
990860532 5:60321711-60321733 CCCCATCACAAAGTGAGCAAAGG + Intronic
991098877 5:62769911-62769933 CCCCATCACAAAAAGGGCAAAGG + Intergenic
991105964 5:62842391-62842413 CTCCATCAAAAAGTGTGCAAAGG + Intergenic
991168074 5:63587088-63587110 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
991199525 5:63975736-63975758 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
991232392 5:64350238-64350260 CCCCATCACAAAGTGGGCAAAGG - Intronic
991280368 5:64906492-64906514 CTCCATCAAAAAGTGGGCAAAGG - Intronic
991513819 5:67411491-67411513 TTCCAACACAGAGTGACCAAAGG - Intergenic
991935511 5:71795468-71795490 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
992520047 5:77541272-77541294 CCCCAATATAAAGTGAGCAAAGG + Intronic
993329593 5:86581413-86581435 CCCCATCACAAAGTGGGCAAAGG + Intergenic
993366299 5:87037864-87037886 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
993370784 5:87089722-87089744 CGCCATCAGAAAGTGAGCAAAGG + Intergenic
993476835 5:88376841-88376863 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
993528226 5:88992946-88992968 CCCCATCACAAAGTGGGCAAAGG + Intergenic
993659890 5:90620423-90620445 CTCCATCAAAAAGTGGGCAAAGG - Intronic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
994338223 5:98594747-98594769 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
994536669 5:101039673-101039695 CACCATCAAAAAGTGAGCAAAGG + Intergenic
994601717 5:101913669-101913691 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
994707060 5:103219796-103219818 CCCCATCACAAAGTGGGCAAAGG - Intergenic
994838039 5:104882679-104882701 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
995316382 5:110779271-110779293 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
995398221 5:111712025-111712047 CTCCATCAAAAAGTGGGCAAAGG - Intronic
995436610 5:112143591-112143613 GGCCAACACAAAGAGAGACAGGG - Intronic
995711889 5:115044250-115044272 CTCCAATAAAAAGTGAGCAAAGG + Intergenic
995715249 5:115076314-115076336 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
995775124 5:115716871-115716893 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
995799223 5:115975495-115975517 TTCCAACACACAGAGAAAAAAGG - Intronic
996072053 5:119142354-119142376 CTCCATCAAAAAGTGAGTAAAGG + Intronic
996109849 5:119552504-119552526 CTCCATCAAAAAGTGGGCAAAGG - Intronic
996317648 5:122178557-122178579 CCCCATCAAAAAGAGGGCAAAGG - Intronic
996794254 5:127327115-127327137 CTGCAAAACACAGACAGCAAGGG + Intronic
996831736 5:127747929-127747951 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
997301042 5:132805526-132805548 CCCCATCAAAAAGTGAGCAAAGG + Intronic
998427614 5:142042251-142042273 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
998507578 5:142684602-142684624 GACCAACACAAAGAAAACAAAGG + Intronic
998716019 5:144885555-144885577 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
998780953 5:145656070-145656092 CCCCATCACAAAGTGGGCAAAGG + Intronic
998935062 5:147226335-147226357 CTTCCACCCACAGAGAGCAAGGG + Intergenic
998989932 5:147804417-147804439 CTCCAGCAGACAGAGGGCAAGGG - Intergenic
999128574 5:149265268-149265290 CTCCCTCACACAGACAGCAAAGG - Intergenic
999238247 5:150112922-150112944 CCCCAGCTCAGAGAGAGCAAGGG + Intronic
999873866 5:155781217-155781239 CTTCAACAAAAACATAGCAAGGG - Intergenic
1000034070 5:157429615-157429637 CCCCATCACAAAGTGGGCAAAGG + Intronic
1000467399 5:161596857-161596879 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1000560471 5:162781415-162781437 CTCCAAACAAAAGAGAGAAAAGG - Intergenic
1001021985 5:168190699-168190721 GCCCAACACAAAGTGAGGAAAGG - Intronic
1001149243 5:169212441-169212463 CCCCAACAAAAAGTGGGCAAAGG - Intronic
1001345900 5:170898353-170898375 CCCCATCACAAAGTGGGCAAAGG - Intronic
1002390144 5:178904634-178904656 CTACAACAGAAATAGAACAATGG - Intronic
1003103539 6:3195836-3195858 CGCCAACACAAGAACAGCAAGGG + Intergenic
1003108457 6:3233165-3233187 CCCCATTAAAAAGAGAGCAAAGG - Intronic
1003838350 6:10094674-10094696 CTCTATCACAAGAAGAGCAAGGG + Intronic
1003839856 6:10108478-10108500 CTGCAAATCACAGAGAGCAAGGG + Intronic
1004760583 6:18661686-18661708 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1005012047 6:21345385-21345407 CCCCGTCAAAAAGAGAGCAAAGG + Intergenic
1005745274 6:28831373-28831395 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1005780388 6:29185901-29185923 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1005799597 6:29407721-29407743 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1007338610 6:41173600-41173622 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1008243806 6:49145927-49145949 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1008350855 6:50488505-50488527 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1008361978 6:50630832-50630854 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1008407149 6:51131175-51131197 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1008819476 6:55613113-55613135 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1008923098 6:56863223-56863245 CTCATACACACAGAGAGCAAAGG + Intronic
1009241267 6:61188775-61188797 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1009399069 6:63232607-63232629 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1009500472 6:64406627-64406649 CTCCATCAAAAAGTGAGCGAAGG + Intronic
1009528111 6:64773798-64773820 CTCCATTACAAAGTGGGCAAAGG - Intronic
1009871322 6:69455450-69455472 TTCCAACATTAAAAGAGCAAAGG + Intergenic
1009880993 6:69565804-69565826 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1010015120 6:71096082-71096104 CCCCATCAAAAAGTGAGCAAGGG - Intergenic
1010745079 6:79551731-79551753 CTCCACCACAAAGTGAACATGGG - Intergenic
1010852909 6:80800102-80800124 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1010915449 6:81612047-81612069 CTTCAAAACAAATAGAGGAAAGG + Intronic
1011016845 6:82766075-82766097 CTCCATCAAAAACAGAGCACTGG + Intergenic
1011065989 6:83326554-83326576 CTCCATCAGAAAGTGGGCAAAGG + Intronic
1011072823 6:83404326-83404348 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1011700931 6:89954102-89954124 CTCCACCACAAAGAAAGAAATGG + Intronic
1011843245 6:91528192-91528214 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
1011870672 6:91888288-91888310 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1012081462 6:94763072-94763094 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1012089060 6:94869130-94869152 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1012190307 6:96271507-96271529 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1012364681 6:98424166-98424188 CTCCATCAAAAAGTGGGCAAGGG - Intergenic
1012373039 6:98529980-98530002 CACACACACAACGAGAGCAAAGG + Intergenic
1012426084 6:99116208-99116230 CTCCAGCACAGAGAGGGGAATGG + Intergenic
1012443735 6:99287766-99287788 CTCTACCACAGAGACAGCAAAGG + Intronic
1013263912 6:108474707-108474729 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1014176504 6:118337068-118337090 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1014180611 6:118380337-118380359 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1014376228 6:120678585-120678607 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1014423422 6:121272427-121272449 CCCCATCAAAAAGAGGGCAAAGG + Intronic
1014480924 6:121935711-121935733 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1015007404 6:128300041-128300063 CCCCAACAAAAAGTGGGCAAAGG + Intronic
1015259491 6:131219313-131219335 CTCCAACAAAAATGGAGAAATGG - Intronic
1015554681 6:134449404-134449426 CTCCATCAGAAAGAAAGAAAAGG - Intergenic
1015774564 6:136800649-136800671 CTCCAAAACATAGAGCCCAAGGG - Intergenic
1015951710 6:138559592-138559614 CTCCAACACCAAGACAACAGTGG + Intronic
1016042420 6:139444830-139444852 CTCAAACAGAAAGAGATCTAGGG - Intergenic
1016106027 6:140163449-140163471 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1016275425 6:142346471-142346493 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1016433451 6:144011269-144011291 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1017056237 6:150438344-150438366 CTCCAGCAAAAAGTGGGCAAAGG + Intergenic
1017271608 6:152513798-152513820 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1017976438 6:159361691-159361713 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1018721227 6:166574060-166574082 CTACAGCACACAGAGGGCAATGG + Intronic
1019064439 6:169284918-169284940 CTCCAAAATACAGAGAGGAATGG + Intergenic
1019772058 7:2889869-2889891 CTCCATTAAAAAGTGAGCAAAGG - Intergenic
1019972806 7:4555281-4555303 CTCCATCTAAAAGTGAGCAAAGG - Intergenic
1020463475 7:8449685-8449707 CTCCAACACAAACATAACATGGG - Intronic
1020466446 7:8485151-8485173 CACTATCACAAAGAGAGCACAGG - Intronic
1020873796 7:13668894-13668916 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1021125704 7:16849627-16849649 CTCCATTACAAAGTGGGCAAAGG - Intergenic
1021187536 7:17582683-17582705 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1022432456 7:30339094-30339116 CCCCATCAAAAAGAGGGCAAAGG - Intronic
1022695201 7:32698473-32698495 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1022785528 7:33633823-33633845 CTCCAACTCACACAGAGGAAAGG - Intergenic
1024015421 7:45310165-45310187 CTAGAAGACAAAGAGACCAAAGG - Intergenic
1024018187 7:45338160-45338182 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1024165884 7:46729825-46729847 CTCCATTAAAAAGTGAGCAAAGG + Intronic
1024459932 7:49649490-49649512 CTCTATCACAAATATAGCAAGGG + Intergenic
1024956281 7:54924809-54924831 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1025001797 7:55321847-55321869 CTCCATTACAAAGTGGGCAAAGG + Intergenic
1025223373 7:57135385-57135407 AACAAACACAAAGACAGCAATGG - Intronic
1025620515 7:63166055-63166077 CTCCACCCCACAGAGAGAAAAGG - Intergenic
1025634177 7:63307037-63307059 AACAAACACAAAGACAGCAATGG - Intergenic
1025648521 7:63441129-63441151 AACAAACACAAAGACAGCAATGG + Intergenic
1025862552 7:65345195-65345217 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1027535333 7:79392681-79392703 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1027621782 7:80495874-80495896 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1027910260 7:84241427-84241449 CTCCATCAAAAAGTGAGCCAAGG - Intronic
1028048593 7:86153840-86153862 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1028181098 7:87725913-87725935 CCCCAACAAAAAGTGGGCAAAGG - Intronic
1028856421 7:95598197-95598219 CTCCTAGACGAAGAGGGCAAAGG - Intergenic
1028886914 7:95944193-95944215 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1029193026 7:98785276-98785298 CTCCATCAGAAAGAAAGGAAAGG + Intergenic
1029780717 7:102729371-102729393 CCCCATCAAAAAGAGGGCAAAGG + Intergenic
1030030304 7:105363346-105363368 CCCCATCAAAAAGAGGGCAAAGG + Intronic
1030202136 7:106916541-106916563 CAGCAAGACAAAGACAGCAAGGG + Intergenic
1030243142 7:107351629-107351651 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1030350439 7:108478944-108478966 CTCCAACAGTAAGTGGGCAAAGG + Intronic
1030436222 7:109524441-109524463 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1030501815 7:110368748-110368770 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1030510535 7:110477501-110477523 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1030753221 7:113258520-113258542 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
1031199352 7:118660075-118660097 CACCGAGAAAAAGAGAGCAAGGG - Intergenic
1031592040 7:123604994-123605016 CTCCAACAGAAAGAAATCAATGG + Intronic
1031666857 7:124495326-124495348 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1031705874 7:124980291-124980313 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1031809271 7:126345783-126345805 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1032508310 7:132452445-132452467 GTCCAACACAAGGAAAGCGATGG + Intronic
1032864377 7:135911251-135911273 CTTCAACACAAACAGCTCAATGG - Intergenic
1033802693 7:144919665-144919687 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1033837774 7:145336191-145336213 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1033900532 7:146133235-146133257 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1035453488 7:158994387-158994409 CTCCATTAAAAAGAGGGCAAAGG + Intergenic
1035492171 7:159289828-159289850 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1035645814 8:1218578-1218600 GTCCAAAGCAAAAAGAGCAAAGG - Intergenic
1035782783 8:2242071-2242093 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1035790780 8:2302784-2302806 CTCCATCAAAAAGAGGGCGAAGG - Intergenic
1035802025 8:2418921-2418943 CTCCATCAAAAAGAGGGCGAAGG + Intergenic
1035809347 8:2477518-2477540 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1036537220 8:9661904-9661926 CCCCATCACAAAGTGGGCAAAGG + Intronic
1037028775 8:14074542-14074564 CTCCATCAAAAAGTGTGCAAAGG - Intergenic
1037604101 8:20422938-20422960 CTCCAAGGTAAAGAGAGGAATGG - Intergenic
1037685300 8:21133778-21133800 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1039747542 8:40442634-40442656 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1040092042 8:43408679-43408701 GTCCAACACCAACAGGGCAAAGG - Intergenic
1040390646 8:46947758-46947780 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1040630191 8:49201229-49201251 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1040734503 8:50489597-50489619 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1040842844 8:51803140-51803162 CTCCAACCCACAGTGAGCCAAGG - Intronic
1040942557 8:52847536-52847558 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG + Intronic
1041346027 8:56898828-56898850 CACCAACACAATGAGAACAAAGG - Intergenic
1041473500 8:58237122-58237144 CTCCCACATAAAAAGATCAAAGG + Intergenic
1042002097 8:64135584-64135606 CTCCATAACAGAGAGGGCAAAGG - Intergenic
1042152973 8:65809668-65809690 CCCCATCACAAAGTGGGCAAAGG + Intronic
1042171271 8:65993674-65993696 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1042410970 8:68465119-68465141 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1042725744 8:71874749-71874771 CTCCATCACAAGAACAGCAAGGG - Intronic
1042853039 8:73235675-73235697 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1043552567 8:81391408-81391430 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1043929713 8:86076694-86076716 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1043995311 8:86806878-86806900 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1044154509 8:88826919-88826941 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1044372591 8:91430011-91430033 CTCTACCACAAAAACAGCAAGGG - Intergenic
1044374463 8:91453028-91453050 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1044499836 8:92940661-92940683 CTCCAACACAATAATAGCACAGG + Intronic
1044516643 8:93146658-93146680 CTCCAAAAGAAAGAGGGCAAGGG - Intronic
1044614176 8:94122149-94122171 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1044786188 8:95796061-95796083 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1045103762 8:98870664-98870686 CCCCAACAAAAAGTGGGCAAAGG - Intronic
1045125266 8:99082284-99082306 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1045152667 8:99426735-99426757 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1045267041 8:100627908-100627930 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1045372701 8:101540708-101540730 CTCCATCACAAAGTGAGCTGAGG + Intronic
1045728702 8:105207658-105207680 CTCCATTAAAAAGTGAGCAAAGG + Intronic
1046167387 8:110454331-110454353 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1046241189 8:111496163-111496185 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1046286192 8:112095480-112095502 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1046327065 8:112662842-112662864 CTCCATCACAAAGTGGGAAAAGG + Intronic
1046329492 8:112696894-112696916 CCCCATCACAAAGTGGGCAAAGG + Intronic
1046387532 8:113523579-113523601 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1046740499 8:117822743-117822765 CTGCAAGACAGAGAGAGTAATGG + Intronic
1046951315 8:120022470-120022492 ATCCAACACAAAGAGTTAAAAGG - Intronic
1046977815 8:120302055-120302077 CCCCATTAAAAAGAGAGCAAAGG - Intronic
1047007809 8:120639214-120639236 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1047015865 8:120722568-120722590 CCCCATCAAAAAGTGAGCAACGG - Intronic
1047552561 8:125891472-125891494 CTCTATCAAAAAGGGAGCAAAGG - Intergenic
1047716251 8:127598031-127598053 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1047782633 8:128122663-128122685 CTCAACTGCAAAGAGAGCAAGGG - Intergenic
1048144790 8:131830764-131830786 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1048227344 8:132601092-132601114 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1049021404 8:139959927-139959949 ACCCAAGACACAGAGAGCAAGGG + Intronic
1049324608 8:142015509-142015531 CCCCAAAACACAGACAGCAAGGG - Intergenic
1049494868 8:142925003-142925025 ATGCAACACAAACAGAACAATGG + Intergenic
1050623987 9:7484201-7484223 CTCCATCACAAATTGGGCAAAGG + Intergenic
1050840479 9:10142443-10142465 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1050963855 9:11771521-11771543 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1051321603 9:15911368-15911390 CCCCATCAAAAAGTGAGCAAAGG - Intronic
1051354415 9:16228631-16228653 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1051653931 9:19359989-19360011 CTCTATCACACTGAGAGCAATGG - Intronic
1052089581 9:24312148-24312170 CTCTATCACAAAAACAGCAAGGG + Intergenic
1052221085 9:26023292-26023314 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1052264698 9:26558496-26558518 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1052566948 9:30166637-30166659 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1053232580 9:36423398-36423420 CTCCAACACAATGAGAGAGGAGG + Intronic
1055344650 9:75322528-75322550 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1055996429 9:82165314-82165336 CCCCATTACAAAGTGAGCAAAGG + Intergenic
1056053931 9:82800912-82800934 TTGCAATACAAAGAAAGCAAGGG - Intergenic
1056321407 9:85438717-85438739 CTTCAACAAAAAGTGGGCAAAGG + Intergenic
1056887963 9:90462061-90462083 CCCCACCACAAAGTGGGCAAAGG + Intergenic
1057000440 9:91504075-91504097 CACCAACAAAGAGAGAGCTATGG + Intergenic
1058253609 9:102733334-102733356 CACCAAGACAAAGAGAATAAAGG - Intergenic
1058319054 9:103607103-103607125 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1058511968 9:105728901-105728923 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1058819722 9:108718754-108718776 CCCCATCAAAAAGAGAGCGAAGG + Intergenic
1058826092 9:108777220-108777242 CTCCAACCCAAAGTGAACATGGG + Intergenic
1059027049 9:110646084-110646106 CACCATCACAAAGTGGGCAAAGG + Intergenic
1059298016 9:113289766-113289788 CTCATACACAAATAGATCAATGG - Intronic
1060450150 9:123730424-123730446 CCCCATCAAAAAGAGGGCAAAGG + Intronic
1203376490 Un_KI270442v1:381715-381737 CTGCTACAGAAGGAGAGCAAGGG - Intergenic
1186333117 X:8557493-8557515 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1187463821 X:19511485-19511507 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1187548604 X:20278863-20278885 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1187994225 X:24907919-24907941 CTACAGCATAAAGAGAGAAATGG + Intronic
1188092633 X:25982057-25982079 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1188145512 X:26607587-26607609 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1188198173 X:27264695-27264717 CCCCAACAAAAAGTGGGCAAAGG + Intergenic
1188262498 X:28036927-28036949 CACCAACACAAAGACAGCCAGGG + Intergenic
1188348843 X:29102173-29102195 CTTCAACACAATGAAAGCCATGG + Intronic
1188848800 X:35106782-35106804 CTCCATCAGAAAGTGGGCAAAGG + Intergenic
1188860810 X:35253047-35253069 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1188867578 X:35332457-35332479 CTCCATCAAAAAGTGAGCAAAGG - Intergenic
1189501753 X:41567407-41567429 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1189529835 X:41868590-41868612 CCACAACATAAACAGAGCAAGGG + Intronic
1190591643 X:52008561-52008583 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1190836577 X:54106718-54106740 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1191677106 X:63803070-63803092 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1191725997 X:64281884-64281906 CCCCATCAAAAAGAGGGCAAAGG + Intronic
1191751991 X:64552735-64552757 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1191780574 X:64859938-64859960 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1192000273 X:67142439-67142461 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1192100974 X:68264425-68264447 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1192853751 X:74985518-74985540 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1192902685 X:75516905-75516927 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1192973332 X:76256190-76256212 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1192999036 X:76543411-76543433 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1193066042 X:77261410-77261432 CTCCATCAAAAAGTGAGCGAAGG + Intergenic
1193353629 X:80490490-80490512 CCCCATCAAAAAGAGGGCAAAGG - Intergenic
1193412382 X:81180368-81180390 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1193486824 X:82094797-82094819 CTCTAACAAAAAGAGTGAAAGGG + Intergenic
1193577867 X:83225955-83225977 CTCCATTACAAAGTGTGCAAAGG - Intergenic
1193610041 X:83620229-83620251 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1193646047 X:84069729-84069751 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1193687583 X:84596838-84596860 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1193705687 X:84818458-84818480 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1193780360 X:85694000-85694022 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1193845366 X:86463840-86463862 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1193869899 X:86784294-86784316 CCCCAACAAAAAGTAAGCAAAGG + Intronic
1194020919 X:88691440-88691462 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1194035476 X:88865436-88865458 CTACCACAAAAAGAGAACAAGGG + Intergenic
1194281052 X:91954782-91954804 CTCCATCAAAAAGTAAGCAAAGG - Intronic
1194514859 X:94840020-94840042 CCCCAACACAACGTGGGCAAAGG - Intergenic
1194636065 X:96346191-96346213 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1194761279 X:97798732-97798754 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1194855773 X:98926796-98926818 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
1195153774 X:102101139-102101161 CTCCATCAGAAAGTGGGCAAAGG + Intergenic
1195225839 X:102792237-102792259 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1195337710 X:103872557-103872579 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1195817940 X:108908954-108908976 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1195993523 X:110707962-110707984 CCCCATCAAAAAGTGAGCAAAGG + Intronic
1196176832 X:112647491-112647513 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1196223887 X:113142533-113142555 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1196438251 X:115694125-115694147 ATATAACACAGAGAGAGCAAAGG + Intergenic
1197045955 X:121998861-121998883 CACCATCAAAAAGTGAGCAAAGG - Intergenic
1197847525 X:130819043-130819065 CTCCATCAAAAAGTGGGCAAAGG + Intronic
1197987401 X:132280610-132280632 CACAAAGACAAAGAGATCAATGG - Intergenic
1198571771 X:137964989-137965011 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1198680277 X:139174224-139174246 CTCCATCAAAAAGTGGGCAAAGG - Intronic
1199027207 X:142954078-142954100 CCCCATCAAAAAGTGAGCAAAGG - Intergenic
1199075660 X:143522449-143522471 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1199230223 X:145428505-145428527 CTGCAACAGAATGAGAGGAAAGG - Intergenic
1199401935 X:147408738-147408760 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1199887406 X:152034316-152034338 CTCCATCAGAAAGTGGGCAAAGG - Intergenic
1200574555 Y:4871680-4871702 CCCCATCAAAAAGTGAGCAAAGG + Intergenic
1200598647 Y:5179450-5179472 CTCCATCAAAAAGTAAGCAAAGG - Intronic
1200718997 Y:6582517-6582539 CCCCATCACAAAGTGGGCAAAGG - Intergenic
1200881935 Y:8223472-8223494 CTCCATCAAAAAGTCAGCAAAGG + Intergenic
1200883371 Y:8243853-8243875 CTCCATCAAAAAGTGGGCAAAGG + Intergenic
1201238752 Y:11937503-11937525 CTCCATCAAAAAGTGAGCAAAGG + Intergenic
1201489069 Y:14522597-14522619 CTGCAAGAAAAAGAGAGCTAGGG - Intergenic
1201498344 Y:14614257-14614279 CCCCAACAAAAAGTGGGCAAAGG - Intronic
1201615697 Y:15895649-15895671 CTCCATCAAAAAGTGGGCAAAGG - Intergenic
1201790352 Y:17833045-17833067 CTGCAATACAAATATAGCAACGG + Intergenic
1201811202 Y:18072944-18072966 CTGCAATACAAATATAGCAACGG - Intergenic
1201866723 Y:18663663-18663685 CCCCATCACAAAGTGGGCAAAGG + Intergenic
1202013882 Y:20379577-20379599 CCCCAACAAAAAGTGGGCAAAGG - Intergenic
1202029933 Y:20560880-20560902 CACTATCACAAAAAGAGCAAAGG + Intergenic