ID: 1041201431

View in Genome Browser
Species Human (GRCh38)
Location 8:55454287-55454309
Sequence CGGGGTCAATGCGGCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041201431_1041201442 19 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201442 8:55454329-55454351 TGCTGAGGGCCTCCAGCAGCTGG 0: 1
1: 0
2: 3
3: 45
4: 370
1041201431_1041201443 20 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201443 8:55454330-55454352 GCTGAGGGCCTCCAGCAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 340
1041201431_1041201436 -6 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201436 8:55454304-55454326 ACCCCGATTATGAAGGGCGTGGG 0: 1
1: 0
2: 1
3: 2
4: 26
1041201431_1041201446 28 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201446 8:55454338-55454360 CCTCCAGCAGCTGGGCCGGCAGG 0: 1
1: 2
2: 6
3: 56
4: 597
1041201431_1041201444 24 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201444 8:55454334-55454356 AGGGCCTCCAGCAGCTGGGCCGG 0: 1
1: 0
2: 11
3: 92
4: 451
1041201431_1041201441 5 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201441 8:55454315-55454337 GAAGGGCGTGGGTGTGCTGAGGG 0: 1
1: 0
2: 0
3: 28
4: 274
1041201431_1041201435 -7 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201435 8:55454303-55454325 GACCCCGATTATGAAGGGCGTGG 0: 1
1: 0
2: 1
3: 3
4: 33
1041201431_1041201440 4 Left 1041201431 8:55454287-55454309 CCTGGAAGGCCGCATTGACCCCG 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1041201440 8:55454314-55454336 TGAAGGGCGTGGGTGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041201431 Original CRISPR CGGGGTCAATGCGGCCTTCC AGG (reversed) Intronic
900228488 1:1543925-1543947 CGTGGTCAATGTGGACATCCAGG - Exonic
902962946 1:19977577-19977599 CTAGGTCAATCCGGCCCTCCAGG - Intronic
915517259 1:156420806-156420828 CTGGGTCGCTGCGGTCTTCCCGG - Intronic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1070841755 10:79492289-79492311 CTGGGGACATGCGGCCTTCCGGG + Intergenic
1076514606 10:131036883-131036905 CGTGGTCACTGCGGATTTCCAGG - Intergenic
1077021149 11:417672-417694 GGGGGTCAAGGCAGGCTTCCTGG - Intergenic
1077235042 11:1477659-1477681 CGTGGTCAGTGCCCCCTTCCTGG + Intronic
1078009940 11:7565244-7565266 TGGGGTCCAGGTGGCCTTCCAGG + Intronic
1082750157 11:57006271-57006293 TGGGGTCAGTGGGGCCTTCCTGG + Intergenic
1085740350 11:79073221-79073243 TGGGGTCAATTCTGGCTTCCTGG + Intronic
1088989616 11:114940856-114940878 CGGGGTCACGGGGGCCTTCAGGG + Intergenic
1102572484 12:113835539-113835561 CGGGGTCAGTGGGGGCTGCCGGG + Intronic
1103907428 12:124334874-124334896 CACGGGCAATGAGGCCTTCCTGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1132633390 16:930622-930644 CGGGGGCTGTGCGGACTTCCCGG + Intronic
1133906996 16:10031525-10031547 CGTGGTCAGTGCTGCGTTCCTGG + Intronic
1135557955 16:23452928-23452950 GTGGATCAATGCGGCCTTCAGGG - Exonic
1139779678 16:69340104-69340126 CTGGGTCCATGCTGCCTGCCCGG - Intronic
1147384034 17:40071395-40071417 CGGGGCCAATGCGGCATCCACGG - Intronic
1153139471 18:1954894-1954916 AGGGGTGAGTGGGGCCTTCCTGG + Intergenic
1156395090 18:36692035-36692057 GGTGGTCAAGGCAGCCTTCCTGG + Intronic
1159888443 18:73932839-73932861 TGGGGTCCATGCAGCCTTCAGGG - Intergenic
1160891141 19:1379366-1379388 CGGGGTCAAGCCTGTCTTCCCGG - Intergenic
1161517344 19:4703813-4703835 TGGGGGCAATGGGGCCTTTCTGG + Intronic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
1166673049 19:44722924-44722946 TGGGGTCAAGGAGGGCTTCCTGG + Intergenic
1167153391 19:47723063-47723085 GGGGGTCAAGGAGGACTTCCAGG - Intronic
937991591 2:127665069-127665091 CGGGGTACATGGTGCCTTCCTGG - Intronic
1174443005 20:50570871-50570893 CGGGGGCAATTTGGCCTACCAGG - Intronic
1174452688 20:50629599-50629621 CAGGGTCAATGCTGCCCCCCAGG + Intronic
1175065019 20:56277129-56277151 GGGGAACAATGGGGCCTTCCTGG - Intergenic
1175940926 20:62537267-62537289 CGGGGACACTGCTGCCTGCCAGG - Intergenic
1181181351 22:21070662-21070684 GAGGGTAAATGCTGCCTTCCAGG - Intergenic
1184457850 22:44621640-44621662 CGGGGTCACTGCCTCCTCCCCGG - Intergenic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
1185372208 22:50466167-50466189 TGGGGTCAACGCGGCCTTCCAGG - Exonic
954306390 3:49727784-49727806 CAGGGTGAATGTGGCCTGCCTGG - Intronic
959037379 3:101383516-101383538 CGGGGGCATGGGGGCCTTCCTGG - Intronic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
969470098 4:7382509-7382531 TGGAGTCAATAAGGCCTTCCCGG - Intronic
973920646 4:55681607-55681629 CGGGCTCATTGGGGCCATCCTGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992726471 5:79612444-79612466 CGGGGTCACGTCGGTCTTCCGGG + Exonic
997609952 5:135208949-135208971 AAGGGCCAATGCTGCCTTCCTGG - Intronic
1002182074 5:177435898-177435920 CGGGGTGAATACGGCCCTGCAGG - Intronic
1006485321 6:34335278-34335300 CGGGGTCAGTGTGGCCTATCAGG + Intronic
1007782244 6:44261107-44261129 CTGGCTCCATGAGGCCTTCCCGG + Intronic
1015139770 6:129916823-129916845 CTGTGTCAATGAGGGCTTCCAGG + Intergenic
1018414556 6:163590142-163590164 CGGGGGCAAGGCTGACTTCCAGG - Intergenic
1019592278 7:1841663-1841685 AGGGGCCAGTCCGGCCTTCCCGG + Intronic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1023038847 7:36154867-36154889 TGGTATCAATGCCGCCTTCCTGG + Exonic
1023838636 7:44082823-44082845 CGGGGTCAAGGGGGCGTCCCCGG + Intergenic
1027780017 7:82508367-82508389 AGGGGGCAAGGGGGCCTTCCTGG + Intergenic
1028121372 7:87059539-87059561 CGGCGGCAAGGCAGCCTTCCCGG + Exonic
1030820700 7:114087536-114087558 CGGGGCCACTGTGGACTTCCAGG - Intronic
1031836361 7:126685484-126685506 AGGGGTCAGAGGGGCCTTCCTGG - Intronic
1034869394 7:154670239-154670261 CGTGGTCATTGCAGCCTTCTCGG + Intronic
1036538553 8:9677964-9677986 GGGGGTCAAGGAAGCCTTCCTGG - Intronic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1044823636 8:96176501-96176523 CAGGGTCAAGACTGCCTTCCAGG + Intergenic
1052024123 9:23556207-23556229 GGGGAGCAATGCTGCCTTCCAGG + Intergenic
1185478837 X:431072-431094 GGGGGTCACTGCCCCCTTCCTGG + Intergenic
1196423348 X:115545037-115545059 CGGGGCAAATGCCGCCTACCCGG + Intergenic
1200079706 X:153570158-153570180 CGGGCTCAGGGCCGCCTTCCCGG + Intronic