ID: 1041205644

View in Genome Browser
Species Human (GRCh38)
Location 8:55495544-55495566
Sequence CCCTGGAAGCCACTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 3, 2: 1, 3: 28, 4: 256}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041205644_1041205655 3 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205655 8:55495570-55495592 TGGGCTCCAGGGGGCCTCCCAGG No data
1041205644_1041205658 8 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205658 8:55495575-55495597 TCCAGGGGGCCTCCCAGGGGTGG No data
1041205644_1041205657 5 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205657 8:55495572-55495594 GGCTCCAGGGGGCCTCCCAGGGG No data
1041205644_1041205652 -7 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205652 8:55495560-55495582 TCCAGGGTCGTGGGCTCCAGGGG No data
1041205644_1041205650 -9 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205650 8:55495558-55495580 CTTCCAGGGTCGTGGGCTCCAGG No data
1041205644_1041205660 16 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205660 8:55495583-55495605 GCCTCCCAGGGGTGGATTTGAGG No data
1041205644_1041205651 -8 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205651 8:55495559-55495581 TTCCAGGGTCGTGGGCTCCAGGG No data
1041205644_1041205656 4 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205656 8:55495571-55495593 GGGCTCCAGGGGGCCTCCCAGGG No data
1041205644_1041205654 -6 Left 1041205644 8:55495544-55495566 CCCCATCACAGTGGCTTCCAGGG 0: 1
1: 3
2: 1
3: 28
4: 256
Right 1041205654 8:55495561-55495583 CCAGGGTCGTGGGCTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041205644 Original CRISPR CCCTGGAAGCCACTGTGATG GGG (reversed) Intronic
900621683 1:3590467-3590489 CTCTGGAAGCCCCGGTCATGAGG + Intronic
901174072 1:7285797-7285819 ACCTGGCAGCCACTATGATTAGG + Intronic
901910612 1:12454648-12454670 CCCTGGAAACCTCAGTCATGAGG - Intronic
902164967 1:14562818-14562840 CTCTGGAAGGCACTGCCATGTGG - Intergenic
902641067 1:17766613-17766635 CCCTGAAGCCCACTGTGGTGGGG + Intronic
904377414 1:30090520-30090542 CTCTGGAAGCCACAGACATGGGG - Intergenic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907835247 1:58102461-58102483 TCCTGGAACCAACTCTGATGAGG + Intronic
909377962 1:74961585-74961607 CCCCGGGGGCCAGTGTGATGTGG - Intergenic
910182806 1:84504657-84504679 GACTAGAAACCACTGTGATGAGG + Intronic
916842300 1:168613128-168613150 CCCTGGCAGCCACTGTGGATAGG - Intergenic
918262699 1:182810089-182810111 CCCTGGAGGACTCTGTGATTGGG + Intronic
918963334 1:191307158-191307180 CCCTGGGAGCTGCTGTGATGGGG - Intergenic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919997566 1:202767357-202767379 CCGTAGGAGCCACTGTGAGGAGG - Intronic
920084180 1:203402841-203402863 CCCTGGAAACTGGTGTGATGAGG - Intergenic
920385498 1:205568366-205568388 CCCTGGAAGGGCCTGAGATGAGG - Intergenic
921746826 1:218749834-218749856 GCCTGGAAGCCACTGTAATATGG + Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
1062855713 10:778552-778574 ACCTGGAAGCCCGTGTGCTGCGG - Intergenic
1064354635 10:14605632-14605654 CCCTGGAACCCACTGAGGGGTGG + Intronic
1065976391 10:30846432-30846454 CCATGAGAGCCACTGCGATGGGG + Intronic
1068083344 10:52346754-52346776 CCCTGGGGGCTGCTGTGATGTGG + Intergenic
1069592800 10:69652404-69652426 CCCTGGGGGCCACTGCAATGGGG + Intergenic
1070916829 10:80160567-80160589 TCCTGGAGGCCAGTGTGAGGTGG - Intronic
1072204920 10:93195241-93195263 CCCTGGAAGCCACTTGGAACAGG + Intergenic
1073385047 10:103119460-103119482 ATCTGGAAGCCAGTGGGATGAGG + Intronic
1074282836 10:112069539-112069561 TCCTGGGAGCCAGTGTGAGGTGG - Intergenic
1074541515 10:114369109-114369131 CCAAGGAAACCACTGTCATGAGG - Intronic
1074782655 10:116813038-116813060 CCTGAGAAGCCACGGTGATGAGG + Intergenic
1074868881 10:117561653-117561675 CCCTGGAAACCACAGCTATGGGG + Intergenic
1075591959 10:123698385-123698407 CCGTGAGAGCCACTGTGATGTGG - Intergenic
1076546551 10:131249328-131249350 CCATGGAAGCCCCTATGCTGGGG - Intronic
1076839511 10:133039147-133039169 CCCTGGAAGCCCCTCTGACCTGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077383720 11:2259367-2259389 GCCTGGGAGCCTCTGTGATAGGG + Intergenic
1078532948 11:12151078-12151100 CCCTGGAAGCCAATGTGATGTGG - Intronic
1079524262 11:21365345-21365367 CCCAGGATGCCACTGTGCAGTGG + Intronic
1080852105 11:36078815-36078837 CCCTGGGAGCCACTGTGACAGGG - Intronic
1082086316 11:48052912-48052934 GCCTGGCAGCCACAGAGATGAGG + Intronic
1082961803 11:58925022-58925044 TCCTGGAAGCCACATTGTTGAGG + Intronic
1083296216 11:61717020-61717042 CCCTGGAAGCCCCACTGGTGTGG + Intronic
1083596384 11:63919854-63919876 GCCTGGAAGCAAGTGTGATCAGG + Intergenic
1083924146 11:65795785-65795807 CCCTGCAAACAACTGTGGTGGGG + Exonic
1083993182 11:66258785-66258807 CCCTGGAAGCCATTGAGCTTGGG + Exonic
1084979803 11:72823001-72823023 CCCTGGCAGCCTCTGGGGTGGGG - Intronic
1087076641 11:94131947-94131969 CCCGGGAAGACACTGAGATAAGG + Intronic
1087135921 11:94720053-94720075 CCCAGAAGGCCACTGTGCTGAGG + Intronic
1089186278 11:116617444-116617466 CATTGCAAGCCACTGAGATGAGG - Intergenic
1090333099 11:125946346-125946368 TCCTGAGAGCCACTGTGAGGTGG + Intergenic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091589495 12:1834891-1834913 CCCTGAAAGCCACCGTGCTGGGG + Exonic
1091623913 12:2108358-2108380 ACCTGGAAGCCACTGTGCCAAGG + Intronic
1091672307 12:2461121-2461143 CTCTTGAATCCACTCTGATGGGG + Intronic
1092933892 12:13342180-13342202 CCCAGGAAGCAAATGTCATGAGG - Intergenic
1094017943 12:25884423-25884445 TCCCTGAAGCCACTGTGATGGGG + Intergenic
1094553362 12:31473229-31473251 GGCTGTAAGCCACTGTGTTGAGG - Intronic
1095696606 12:45150700-45150722 TCCTGTAAGCCACCGTGAAGAGG - Intergenic
1096017332 12:48289037-48289059 CCCTGGAAGTCACTCAGCTGAGG + Intergenic
1096179875 12:49544753-49544775 CCTTGGAAGCCAAGGTGGTGGGG - Intronic
1096592169 12:52667612-52667634 CCCTGGGAGCCGCTGCGTTGTGG + Intergenic
1097492350 12:60285564-60285586 CCCTGCAAGACATTTTGATGGGG + Intergenic
1098213834 12:68194934-68194956 TCCTGGAATCCACTCTGATTGGG + Intergenic
1099343650 12:81471031-81471053 ACCTGGAAGACATTGTGCTGAGG - Intronic
1100387301 12:94115479-94115501 CGCAGGAAGAAACTGTGATGTGG + Intergenic
1102496273 12:113321270-113321292 CCCTGACTGCCACAGTGATGGGG - Exonic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1104190754 12:126479955-126479977 CCCTGGAAGCCACAGTCTTTTGG + Intergenic
1104805295 12:131586012-131586034 CCCTGGGGACCACTGTGATGGGG + Intergenic
1104913559 12:132252034-132252056 CCCAGGAATCCTCCGTGATGAGG + Intronic
1106804381 13:33290958-33290980 ACCTGTAAACCACTGTTATGTGG + Intronic
1108310753 13:49187607-49187629 CCGTAGGAGCCACTGTGAGGAGG - Intronic
1111012405 13:82329056-82329078 CACTTGAAGCCCCTGTAATGTGG + Intergenic
1111337514 13:86841468-86841490 CTCTGGAAGCCACTTTGGTGGGG - Intergenic
1113632701 13:111899133-111899155 CCCGGGTTGCCACTGGGATGTGG - Intergenic
1113750060 13:112770713-112770735 CCCTGGGAGCCACTGAGAGACGG + Intronic
1118473263 14:66094295-66094317 CCCTGGGAGCCGCAGTGATGGGG - Intergenic
1118834875 14:69470533-69470555 CCCTTGTAGACACAGTGATGTGG - Intergenic
1119105257 14:71917322-71917344 ACCAGGCAGCCTCTGTGATGAGG - Intergenic
1119520529 14:75281194-75281216 CCCAGGGAGCCACTGTGCAGAGG - Exonic
1121406972 14:93725095-93725117 CCCTGGAAGGCAGGGTGAGGAGG + Intronic
1123926418 15:25116430-25116452 ACATGTAAGCCACTGTTATGAGG + Intergenic
1124890369 15:33726575-33726597 GCCTGGGGGCCACTGTGCTGGGG - Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129678048 15:77643049-77643071 CTCTGACAGCCACTGTGGTGTGG + Intronic
1131651386 15:94403469-94403491 CCCAGACAGCCACTGTGAGGAGG + Intronic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1137505988 16:49054057-49054079 CCCTGGGAGACACTGGGGTGGGG - Intergenic
1137717105 16:50604714-50604736 CACTGGAAGCCCCTGTGCAGAGG - Intronic
1138576020 16:57907839-57907861 CCCTGAGAGCCACTGTGAGGTGG - Intronic
1139592680 16:67942265-67942287 CCCTAGAGGCCACTGTGAGCAGG + Intronic
1141495378 16:84406210-84406232 GCCTGGAAGCCACTAAGAAGGGG + Intronic
1141612210 16:85188048-85188070 GCCTGGCAGCCACTGTGAACAGG - Intergenic
1142636433 17:1260360-1260382 CGCAGGAAGCCCCTGGGATGGGG + Intergenic
1143295898 17:5871757-5871779 CCATGGAAGCCACAGTGATTCGG + Intronic
1144811008 17:17998942-17998964 CTCTGGAAGCAACTGTCATCAGG + Intronic
1145217255 17:21061508-21061530 CCCTGGGAGCCACCAAGATGGGG - Intergenic
1145294076 17:21574464-21574486 CCCTGGGAATCGCTGTGATGGGG + Intergenic
1145369759 17:22298722-22298744 CCCTGGGAATCGCTGTGATGGGG - Intergenic
1145878829 17:28339564-28339586 CCCTTGAAGCCACTGAGCTTGGG - Exonic
1149362757 17:55911571-55911593 CCCTGGGGGCCACTGAAATGGGG - Intergenic
1151963321 17:77418881-77418903 CCCTGGAAGCCACAGCCAGGAGG + Intronic
1152178020 17:78800578-78800600 CCATGGAAGCCACTGTGTGGGGG - Intronic
1154018253 18:10638846-10638868 TTCTGGGAGTCACTGTGATGAGG - Intergenic
1154179792 18:12124761-12124783 CCATGGAAGTAACTGTGATGTGG + Intronic
1154186619 18:12190736-12190758 TTCTGGGAGTCACTGTGATGAGG + Intergenic
1154234426 18:12590720-12590742 CCCAGGAAGCCACTCTCAAGCGG + Intronic
1157006596 18:43590348-43590370 CCCTGGGAGCCACTGCAGTGGGG - Intergenic
1158023525 18:52870077-52870099 CCCTGAGAGCTACTGTGATGGGG - Intronic
1158224020 18:55182025-55182047 CCCTGGGTGGCACTGTGCTGGGG - Intergenic
1160088371 18:75801468-75801490 CCCTGGAGGGCCATGTGATGAGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160827211 19:1086154-1086176 TCCTGGAAGCCTCTGGGAGGAGG - Exonic
1161098843 19:2410193-2410215 CCCTGGCAGCCACTTTGAGCTGG - Intronic
1161456920 19:4374283-4374305 CCCTGGCTGCCACTCTGTTGTGG - Intronic
1161660875 19:5545326-5545348 CCCAAGACGCCACTGAGATGGGG + Intergenic
1163294610 19:16404297-16404319 CCCTGGAACTCCCTGTGTTGTGG + Intronic
1164147241 19:22519515-22519537 CCCAGGAAGCCATTGTAAGGAGG + Intronic
1164586683 19:29480225-29480247 CCCCTGAAGCCACTGGCATGTGG + Intergenic
1166452240 19:42911840-42911862 CTCTGGAATCCACTGATATGAGG - Intronic
1166454694 19:42930704-42930726 CTCTGGAATCCACTGATATGAGG - Intronic
1166470649 19:43076610-43076632 CTCTGGAATCCACTGATATGAGG - Intronic
1166481766 19:43180140-43180162 CTCTGGAATCCACTGATATGAGG - Intronic
1168113754 19:54209417-54209439 GCCTGGACGCCCCTGAGATGAGG + Intronic
925924014 2:8657846-8657868 CCCTGGAAGACCCTGCGAGGTGG + Intergenic
926386384 2:12339585-12339607 CCCTTGGAACCACCGTGATGTGG - Intergenic
927033938 2:19152042-19152064 ACCTGGAAGCCCCTGTGATATGG - Intergenic
927502382 2:23591378-23591400 CCCAGGAAGCAGCTGTCATGTGG - Intronic
927673570 2:25089008-25089030 TCCTGGAGGCCTCTGTGCTGGGG + Intronic
927786117 2:25976218-25976240 CCCCGGAAGCCAGAGGGATGCGG - Intronic
927961451 2:27242795-27242817 GCCTGGAAGCCATGGAGATGTGG + Intronic
929913692 2:46115788-46115810 ACCTGGTACCCTCTGTGATGGGG - Intronic
932778565 2:74544887-74544909 CCCTGGGAGATTCTGTGATGGGG - Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
936835205 2:116701482-116701504 GCTTGGAAGTCACTGTGAAGAGG - Intergenic
937750567 2:125472160-125472182 CCAGGGCAGCCACTGTGGTGAGG - Intergenic
938378426 2:130823441-130823463 CCCTGGAAGACACTGGGGTCTGG + Intergenic
941466334 2:165831909-165831931 CCCTGGAAGCCACTGAATTTTGG - Intergenic
942053633 2:172163021-172163043 CCCTGGGAGCCACTGCGATGGGG - Intergenic
943419677 2:187655054-187655076 CCCTGGGAGTGACTGAGATGGGG - Intergenic
943732807 2:191320968-191320990 CCCTAGAAAGCACTGTGCTGGGG - Intronic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
948574623 2:238941716-238941738 CCCTGGATGCTAGTGTGCTGGGG - Intergenic
1169210672 20:3764740-3764762 CCCTCCAAGCAAATGTGATGTGG - Intronic
1170686655 20:18575667-18575689 TCCGGGAAGCCATTCTGATGTGG - Intronic
1172285825 20:33739745-33739767 CTGTTGAAGCCACTGTGACGTGG - Intronic
1172305008 20:33874553-33874575 CCCTGGAAACAACGATGATGGGG + Intergenic
1172914938 20:38436365-38436387 CACTGGGAGTCTCTGTGATGGGG + Intergenic
1174167635 20:48596437-48596459 CTGTGGAAACCACTGGGATGTGG - Intergenic
1174210649 20:48875484-48875506 CCCAGGAAGCCACTCTTCTGTGG - Intergenic
1176656535 21:9592818-9592840 CTGTGGGAACCACTGTGATGGGG + Intergenic
1178902487 21:36608449-36608471 CCATGGAAGACACTGGGATCCGG - Intergenic
1179306268 21:40156160-40156182 TCCTGGAATCCACAGGGATGAGG + Intronic
1180566854 22:16676729-16676751 CCATGGAAGTAACTGTGATCTGG - Intergenic
1181019363 22:20090917-20090939 CCCTAGAAGAGCCTGTGATGGGG + Intronic
1182442248 22:30371399-30371421 CCATGGAGGCAACTGTGATGAGG - Intronic
1183305041 22:37078257-37078279 CCCTAGAAGCAACTGCGTTGAGG + Intronic
1183578579 22:38708404-38708426 TCCTGGAAGCCACTGGCCTGTGG + Intronic
1183715227 22:39529466-39529488 CCCTGGAGGGCACGGTGAAGAGG - Exonic
1183726032 22:39590177-39590199 CCAGGGAAGCCACTATGCTGGGG - Intronic
1184281548 22:43440398-43440420 CCCTGGAGGCCAGGGTGCTGAGG + Intronic
1184520686 22:44992249-44992271 CCCTTGAAGCCACTTTGCAGAGG + Intronic
1184673637 22:46028469-46028491 TCCTGGGTGCCACTGTGCTGTGG - Intergenic
1184848140 22:47101694-47101716 CACTGGAGGCCAATGTGAAGGGG + Intronic
1184866100 22:47202569-47202591 CCCTGGGGGCCACCGTAATGGGG - Intergenic
1184884016 22:47331058-47331080 CCCTGAAAGCCACAGTGGTCTGG - Intergenic
949545600 3:5069473-5069495 CCCTGGAAAACAATGTGAGGTGG - Intergenic
950657937 3:14448912-14448934 CCCTGGAAATAACTGAGATGAGG + Intronic
953787016 3:45918837-45918859 ACCTGGAATCCAGTGTGTTGAGG + Exonic
954710153 3:52501556-52501578 CCCCGGAAGCCAATGTGGGGAGG + Intronic
959147296 3:102564767-102564789 CCCTGAGAGCCACTGGGATCTGG - Intergenic
959484113 3:106908312-106908334 CCCTGGGAGCCGCCATGATGGGG + Intergenic
961192696 3:124975418-124975440 TCCTGGAAGCCACTGAGATTGGG - Intronic
962084814 3:132179619-132179641 CCCTGGAACCTACTGAGTTGAGG + Intronic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
962917451 3:139917514-139917536 TCCATGAAGCCACTGTGGTGAGG - Intergenic
962939394 3:140111806-140111828 CACCAGAAGCCACTGTGATAAGG + Intronic
963804964 3:149714026-149714048 CTCTGGCAGCCGCCGTGATGGGG + Intronic
965246966 3:166285136-166285158 ACCTGGAAACCACTGTGCAGAGG + Intergenic
965289726 3:166864615-166864637 CCCCGGCAGCCACCATGATGGGG + Intergenic
965310106 3:167116483-167116505 CCCTGGGAGCCGCTGCCATGGGG - Intergenic
967048421 3:185759030-185759052 CCATGCAGGCCACTGTGAGGGGG + Intronic
968602326 4:1516065-1516087 GCCAGGCAGACACTGTGATGAGG + Intergenic
969012281 4:4075854-4075876 CCCTGATATCCACTGTGAGGAGG - Intergenic
970008743 4:11435653-11435675 TCCTGGAAGCCACTTTGAGTTGG + Intergenic
970503436 4:16702599-16702621 CCCTTGCAGACCCTGTGATGTGG + Intronic
971757804 4:30723140-30723162 CGCTGGACTCCTCTGTGATGGGG + Exonic
973878473 4:55244556-55244578 CTCTGGAAGCCACAGGGCTGGGG + Intergenic
975177180 4:71301380-71301402 CCCTTGAAGCCACAGTCTTGGGG + Intronic
975490663 4:74984931-74984953 CCCTGCCATCCTCTGTGATGAGG - Intronic
979515881 4:121609544-121609566 CCCTGGAAGCACCTGGGATGAGG - Intergenic
980243001 4:130201835-130201857 CCCTGGGGGCTGCTGTGATGGGG + Intergenic
981066495 4:140491787-140491809 CTCTGGAAGACACTTGGATGTGG - Intronic
981803884 4:148690636-148690658 CTCTGGAAAGCACTGTGATTTGG + Intergenic
982158203 4:152541172-152541194 CCCTGGGGGCTGCTGTGATGGGG - Intergenic
982177507 4:152719731-152719753 CCCTGGATTCCACTGTGTTCTGG - Intronic
982275019 4:153629618-153629640 CCCTGGAAACCCCTGTAATCTGG + Intronic
982381906 4:154757962-154757984 CCCTGCGAGCCAGTGTAATGGGG + Intergenic
982493086 4:156054143-156054165 CCCTGGAATTCACTTTGAAGTGG - Intergenic
985991327 5:3564318-3564340 CACTGAAAGCCATTGTGAAGTGG - Intergenic
986228849 5:5843013-5843035 GGCTGGAAGACAATGTGATGTGG + Intergenic
988093367 5:26569783-26569805 CCCTGGTAGCCACGGCGATGCGG - Intergenic
988731337 5:33976100-33976122 GCCTTGAAGCCACTGTTTTGTGG + Intronic
992807881 5:80355464-80355486 CCCTGGAACCCAGTCTCATGTGG - Intergenic
993454561 5:88112757-88112779 CCCTAGAAGACACAGTGAGGAGG + Intergenic
997461443 5:134055189-134055211 CCCAGGAAGCCACAGGGGTGGGG + Intergenic
997466435 5:134091000-134091022 CCCTGGAAGCCTCTCTGTTCTGG - Intergenic
1000473984 5:161681992-161682014 CCCTGGCAGCCATTGTGTAGAGG - Intronic
1002780211 6:359497-359519 CCCAGGAAGCTCCTGTGCTGTGG + Intergenic
1003493215 6:6641836-6641858 GCCAGGAAGCCAGGGTGATGGGG + Intronic
1003619923 6:7690903-7690925 CCATGGAAGCCAGTGGGATGTGG - Intergenic
1006299722 6:33187182-33187204 CTCTGGAAGCCACTGTGGAAGGG - Intronic
1006917265 6:37602655-37602677 CCCTGGATTCCACTGTCCTGAGG + Intergenic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1013067181 6:106695088-106695110 CCCTGGAAGCCATTGTCTTTTGG - Intergenic
1016685310 6:146874841-146874863 CCCAGCAAGCCATTGTGCTGTGG + Intergenic
1017232998 6:152092682-152092704 CCCTGCAAGGCGCTGTGATTAGG + Intronic
1017955235 6:159171560-159171582 CCCTCGGAGCCACTATTATGTGG - Intronic
1019529029 7:1494536-1494558 CCCTGGAAGCAACTGGAAGGCGG + Intronic
1019800357 7:3084006-3084028 CCCTAGAAGACACAGAGATGGGG + Intergenic
1022382627 7:29874654-29874676 CCCTGGAAGCCACAGCCAGGAGG - Intronic
1023504324 7:40884471-40884493 CTCTGGATGCCATTATGATGAGG + Intergenic
1023521045 7:41050252-41050274 CCCAGAAAGTCACAGTGATGTGG - Intergenic
1024259258 7:47561522-47561544 TCCTAGTAGCCATTGTGATGAGG - Intronic
1025039141 7:55624458-55624480 ACCTGGAAGCCTCTGGGGTGGGG - Intergenic
1027588563 7:80088988-80089010 CCCTGGAATCCACTGTAAGTGGG + Intergenic
1029582666 7:101447765-101447787 CACCGGGAGCAACTGTGATGAGG + Exonic
1029664581 7:101986925-101986947 CCCTGGAAGCCGTGGGGATGTGG + Intronic
1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG + Intergenic
1031836290 7:126685224-126685246 CCCTGGGGGCCACCATGATGGGG + Intronic
1032398326 7:131606696-131606718 CCCTGCAAGGCCCTTTGATGTGG + Intergenic
1033534367 7:142298570-142298592 TCCTGGAATTCACTGAGATGAGG + Intergenic
1033658446 7:143388376-143388398 CCCTGGCCCCCACCGTGATGTGG - Intronic
1034936514 7:155203834-155203856 CCAGTGAAGCCACTGTGAGGAGG - Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1041711161 8:60895712-60895734 TCCTGGAGAGCACTGTGATGAGG - Intergenic
1041770953 8:61471950-61471972 GGATGGAAGCCAGTGTGATGGGG - Intronic
1042004782 8:64168837-64168859 CCCTGGGAGCCACGGCAATGGGG + Intergenic
1042733406 8:71961999-71962021 ACCTGGAAGCCAGTCTGCTGGGG + Intronic
1042864887 8:73348549-73348571 TCCTGGAGGCCACTCTGAGGAGG + Intergenic
1044412726 8:91902099-91902121 TCCTGGAGACCACTATGATGGGG - Intergenic
1044591809 8:93919853-93919875 GTATGGAAGCCACTGTCATGTGG + Intronic
1047793778 8:128233256-128233278 CACTGGACCCCACTGTGAAGAGG - Intergenic
1048438198 8:134437248-134437270 CCCAGGAAGACATTGTGATATGG - Intergenic
1048650358 8:136469036-136469058 CTCTGCAAGCAACTCTGATGGGG + Intergenic
1048814849 8:138322836-138322858 CAAGGGAAGACACTGTGATGCGG + Intronic
1049229884 8:141476444-141476466 CACTGCAGTCCACTGTGATGGGG - Intergenic
1049252603 8:141597245-141597267 CCCTGGGAGCAACTCTGATGGGG - Intergenic
1049256083 8:141614616-141614638 GCCTGGAAGCCAATGTGGTCAGG - Intergenic
1049543587 8:143219412-143219434 CTCTGGAAGCCACGGTCCTGGGG + Intergenic
1049594181 8:143475887-143475909 CCCTAGAAGCCACGGTGAGAGGG + Intronic
1049607088 8:143534741-143534763 CCCTGGTGGCCACAGTGAGGTGG - Intronic
1050402394 9:5270293-5270315 CCCTGGCTGCCACTTTCATGAGG - Intergenic
1051944078 9:22544786-22544808 ACCTCGAAGCCACTGAGATTTGG + Intergenic
1051967646 9:22848108-22848130 CCCTGAAAGCCATTGACATGAGG + Intergenic
1056831064 9:89917991-89918013 CCATGGAGGACACTGTGGTGTGG - Intergenic
1057955774 9:99406706-99406728 GCCTGGCAGCCCCTGTGCTGGGG - Intergenic
1058132937 9:101274073-101274095 CCATGGAAGTCAATGTGATTTGG + Intronic
1058297554 9:103327837-103327859 CCCAGCAAGCTAATGTGATGGGG + Intergenic
1058949330 9:109888877-109888899 CCCTGGAAGCCACTAGGTAGAGG - Intronic
1060509031 9:124218792-124218814 CCTTGGAAGCCCCTGAGAAGAGG + Intergenic
1061298232 9:129688719-129688741 GCCTGGAACCCAGTGTGAGGAGG + Intronic
1061402368 9:130375552-130375574 TGGTGGGAGCCACTGTGATGGGG - Intronic
1061970024 9:134039910-134039932 ACCTGGAAACCAGGGTGATGGGG - Intronic
1062271055 9:135709099-135709121 CACTGGCAGCCACAGTGCTGGGG - Intronic
1062284841 9:135768319-135768341 CCGTGGGGGACACTGTGATGTGG + Intronic
1062461453 9:136664202-136664224 CCCTGGAAGCCCCTGGCACGTGG - Intronic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1186434101 X:9528617-9528639 CCTGGGAAGCCACAGTGCTGAGG + Intronic
1186441826 X:9593536-9593558 CTCTGAAAGCCAGTGGGATGAGG + Intronic
1186870626 X:13767655-13767677 CCCTGGAAGCAACTGTGAACTGG - Intronic
1187507472 X:19888428-19888450 CCCAGGAATCCGCTGAGATGAGG + Intergenic
1189232167 X:39461009-39461031 CCCTGGAAGCCAAGCAGATGCGG + Intergenic
1189973680 X:46442031-46442053 CCTTGGAAGCCATTTTGAAGAGG + Intergenic
1192019490 X:67370290-67370312 CCCTAGCAGCCACTGAGAAGTGG + Intergenic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1193573350 X:83172312-83172334 CCTTGGGGACCACTGTGATGGGG + Intergenic
1195688871 X:107607767-107607789 GGCTGGAAGCCACTGTAAAGTGG + Intergenic
1195976750 X:110535306-110535328 CCCTGTCAGCCCCTGTGATTGGG + Intergenic
1199435541 X:147808625-147808647 CTCAGGAAGTCAGTGTGATGGGG - Intergenic
1200141929 X:153906791-153906813 TCCTGGGAGCCACTGGGAGGGGG + Exonic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1201764852 Y:17566882-17566904 TCCTGGCAGCCCCTGTGTTGGGG - Intergenic
1201836700 Y:18339107-18339129 TCCTGGCAGCCCCTGTGTTGGGG + Intergenic