ID: 1041206688

View in Genome Browser
Species Human (GRCh38)
Location 8:55506539-55506561
Sequence TCTTAAACAAAGATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041206688 Original CRISPR TCTTAAACAAAGATGGTGCA AGG (reversed) Intronic
900919212 1:5660120-5660142 TCTTAAGCCTAGATGGAGCAAGG - Intergenic
901732184 1:11288073-11288095 TGTGAAACAAAAATGGTGCTGGG - Exonic
903408970 1:23123946-23123968 TTTTAAAGAGAGATGGTGAAAGG - Intronic
905458540 1:38105471-38105493 CCAGAAACAAAGATGATGCAAGG - Intergenic
908672754 1:66566325-66566347 TCTGAAACAAAAATGATGGATGG - Intronic
908960550 1:69692213-69692235 TCTCAAAGAAAGATGGAGGAAGG + Intronic
909142163 1:71881569-71881591 TTTTAAATAAAGATTCTGCAAGG + Intronic
909873631 1:80777489-80777511 CCTAAAACAAAGTTGGTCCATGG + Intergenic
910190188 1:84587004-84587026 TCTTAAACAAGTTTGCTGCATGG - Intergenic
916414311 1:164578411-164578433 TCTAAAACAAAAATGTTGAACGG - Intronic
917925109 1:179782669-179782691 TCTCAAACCAAGAAGGTGCCTGG - Intronic
918966734 1:191360340-191360362 TCTAAATCAAAGTTTGTGCAAGG + Intergenic
921411928 1:214845247-214845269 TCTTAAGAAAAGAAGGTCCATGG - Intergenic
922773830 1:228206025-228206047 TCTTCAACAAATACGTTGCAGGG + Intronic
924490286 1:244529943-244529965 TCAAAAACAAAAATGGTGCTGGG - Intronic
1065320465 10:24504170-24504192 TCTTAAACAAAGAAGGTCTTTGG + Intronic
1065753557 10:28910330-28910352 TCCTAAATAACGATGGTGTATGG + Intergenic
1067464064 10:46481246-46481268 TCTTTAACAAAAATGGTAAAGGG + Intergenic
1067623131 10:47903405-47903427 TCTTTAACAAAAATGGTAAAGGG - Intergenic
1068063145 10:52095101-52095123 AGTAAAACAAAGCTGGTGCAGGG - Intronic
1068878214 10:62020362-62020384 TTTTAAACACAGATGGGGGAGGG - Intronic
1071707345 10:88013472-88013494 TCTTAAACAAATTTTTTGCAAGG + Intergenic
1073691435 10:105813748-105813770 TCTCAAACAAGAATGGTGCTAGG + Intergenic
1074487037 10:113895096-113895118 TCTCAAACAATGATGCTGAATGG - Intronic
1074875730 10:117611689-117611711 TCTAAAACAAAGGTGGGGCGGGG - Intergenic
1075818573 10:125285487-125285509 TCTGAAACTAAAATAGTGCATGG + Intergenic
1077580148 11:3412258-3412280 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1079457147 11:20646152-20646174 TCCTAAACCAAGAGGGTGCAGGG + Intronic
1079775738 11:24524029-24524051 TCTTAAACAAAGATGTTGAATGG + Intronic
1079803543 11:24900422-24900444 ACATAAACAAACATGCTGCAAGG - Intronic
1080388938 11:31826470-31826492 TTTTAATTAAAGATGGTTCAAGG + Intronic
1084237072 11:67795085-67795107 TTTTAAACAAAAATGGGGCTGGG + Intergenic
1084835331 11:71797749-71797771 TTTTAAACAAAAATGGGGCTGGG - Intronic
1092559448 12:9595528-9595550 TATTAAACAAAGAAGGCACACGG + Intronic
1093421487 12:18979353-18979375 TCTTAAACAGAGATGGGGAAGGG - Intergenic
1093637213 12:21485439-21485461 TCTTCAACAAAGAATTTGCATGG + Intronic
1094100312 12:26754831-26754853 TCTTTAACAAAAATTGTACAGGG + Intronic
1094731750 12:33184622-33184644 TCACAAATAAAGATGGTACATGG - Intergenic
1098736200 12:74108994-74109016 TCTTAAAATAATTTGGTGCAAGG + Intergenic
1099847538 12:88047108-88047130 TCTTAAAAAATGGTGGTACATGG - Intronic
1101551720 12:105769064-105769086 TGTAAAACATAAATGGTGCAAGG - Intergenic
1105366218 13:19767809-19767831 TCTTAAGCAAAGATCATACAAGG + Intronic
1107294136 13:38892351-38892373 TCTTCAGGAAAGATGGTCCATGG - Intergenic
1111004241 13:82228282-82228304 TCTTAAAAAAAGAGGGTGGATGG - Intergenic
1112336423 13:98520889-98520911 CCTCAAACAAACATGGGGCAGGG - Intronic
1118042538 14:61932744-61932766 TCTGAAGCAAAGATGGGGAAGGG - Intergenic
1118140886 14:63080841-63080863 TCTTAAAAAAAAATGGAGAAAGG + Intronic
1121962875 14:98277347-98277369 TGTTACACAAAGATTTTGCATGG + Intergenic
1122138684 14:99649321-99649343 TCTGGAACCAAGATGGTGCCTGG + Intronic
1122732065 14:103807938-103807960 TCTTAAAAAAAGTTAGTGTAAGG + Intronic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1126235092 15:46374451-46374473 TCTAAAACAGAAATGGTTCAAGG - Intergenic
1127827684 15:62719271-62719293 TCTTAGACAAAGAGGGGCCATGG + Intronic
1130099506 15:80881800-80881822 GCAAAAGCAAAGATGGTGCAGGG + Intronic
1132956657 16:2597889-2597911 TTTTAAATAAAAATGCTGCAAGG - Exonic
1134282966 16:12834188-12834210 TATTAAACATTGCTGGTGCAGGG - Intergenic
1135837436 16:25839406-25839428 TCTAAAACAAAAATGGAGGAAGG - Intronic
1140128989 16:72141895-72141917 TTTAAAACAAACATGGTTCAAGG - Intronic
1146010324 17:29189011-29189033 TCTTCAACAAATAAGTTGCAGGG - Intergenic
1147961674 17:44171226-44171248 TCCTAAACAGAGATGAGGCAGGG + Intronic
1149157573 17:53650284-53650306 TATTAAACAAATATTGTTCATGG - Intergenic
1150899043 17:69249828-69249850 GCTTAAAAAAAGATTGTGAAAGG + Intronic
1150899050 17:69249914-69249936 GCTTAAAAAAAGATTGTGAAAGG + Exonic
1152159888 17:78661212-78661234 TTGTGAACAAAGGTGGTGCAGGG + Intergenic
1153622749 18:6995063-6995085 TCTGAAACAAAGGTGGGGCGGGG - Intronic
1154494948 18:14948803-14948825 TCTTCAGTAAAGGTGGTGCATGG + Intergenic
1154982145 18:21511644-21511666 TCTTAAAGAAAAATGGTGCTGGG - Intronic
1155182368 18:23358890-23358912 TCCTAAGCAGAGAGGGTGCACGG + Intronic
1156020471 18:32594429-32594451 TCTTAACCAAAGATCATGCCAGG - Intergenic
1156157197 18:34317063-34317085 TTTTAAAGCAAAATGGTGCATGG - Intergenic
1156530179 18:37807581-37807603 TTTTAAAAAATGATGATGCATGG + Intergenic
1157310522 18:46549229-46549251 TCCTAAACAAGGATGATGGAAGG + Intronic
1158549266 18:58421045-58421067 TCTTAAACAGAGATGGGGTGAGG - Intergenic
1159183374 18:64939773-64939795 TATTTTATAAAGATGGTGCATGG - Intergenic
1161437199 19:4270692-4270714 TTTTAAAGAAAGGTGGGGCACGG + Intergenic
1161570301 19:5026911-5026933 TCTTCTACAAGGATGGGGCAGGG + Intronic
1162493790 19:11011518-11011540 TCTTAAAGAAAGTTGGGGCTGGG - Intronic
1163541594 19:17914469-17914491 TCTTAAAAAAAAATGGTGGCTGG + Intergenic
1164476738 19:28581306-28581328 TTTGAAAAAAAGCTGGTGCATGG - Intergenic
1164701625 19:30288849-30288871 TCTTGAATAAAGATGGAGAAAGG - Intronic
1165000405 19:32757069-32757091 TCTGCAACATACATGGTGCAAGG + Exonic
1166621991 19:44309398-44309420 TTTAAAACAAAGATGGGGCCGGG - Intergenic
1167030316 19:46954604-46954626 TTTCAAACAAAGATGGTGCAAGG + Intronic
1168504264 19:56920041-56920063 TTTTAAACAATGGGGGTGCAGGG - Intergenic
926273737 2:11387765-11387787 TTTTAAACAAAGATGCTGGTTGG - Intergenic
926763236 2:16298340-16298362 TCTTAAACAAATAGATTGCAAGG - Intergenic
927187775 2:20494541-20494563 TCTTAATCAAAGATGTTAAATGG + Intergenic
927311095 2:21632179-21632201 CCTGAAACATAGAAGGTGCATGG + Intergenic
929191043 2:39139990-39140012 TCTTAGACTAGGATGATGCAAGG + Intergenic
929734235 2:44528717-44528739 TCTTCAACAAAGAAGAAGCAAGG - Intronic
931310990 2:61080413-61080435 TCTTAAACACAAATGGTGAAGGG - Intronic
932387154 2:71345886-71345908 TCTTCTACAAAGATGTTGCCTGG - Intronic
933530221 2:83500089-83500111 TCTTCAACAAAGAGAGTGCATGG - Intergenic
935503737 2:103873238-103873260 CCTAAAACAAAGATGGAGCCAGG + Intergenic
937796221 2:126024212-126024234 ACTTTTACAAAGATGTTGCATGG - Intergenic
941413102 2:165185357-165185379 CCTTAAACAAAGATGGGCAAGGG - Intronic
942119650 2:172764344-172764366 TCTTACACAAAGTAGGTGCCAGG + Intronic
943504735 2:188740896-188740918 TCTCAACCAATGATGGTGTAAGG + Intronic
945649863 2:212543644-212543666 TCTTAAACAAAGAAGAAACAGGG - Intergenic
945898883 2:215516223-215516245 TCTTAAAGACATATGGTGGAAGG - Intergenic
946218477 2:218205161-218205183 AATTAAGCAAAGTTGGTGCAAGG - Intergenic
947012907 2:225585499-225585521 TCTAAAACAAAGCTTGTACATGG + Intronic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
948340383 2:237245921-237245943 TCTTAAAGAACAATGGTGAAGGG - Intergenic
948397457 2:237657093-237657115 ACTGAAACCAAAATGGTGCAAGG - Intronic
948950379 2:241246983-241247005 TCTAAAACCAAAATGGTGCAGGG + Intronic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1169663098 20:8002239-8002261 TCTGGAACAAAGAAGGTGCTTGG - Intronic
1170632907 20:18080682-18080704 TCTTCAACAAATAAGTTGCAAGG - Intergenic
1170979726 20:21200292-21200314 TCTTAAACAAAACTGGTCCCTGG - Intronic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1177838634 21:26212921-26212943 ACTTAAACAATGATCCTGCATGG - Intergenic
1178841378 21:36140198-36140220 TCTTAACCTAAGAAGGTGAATGG + Intronic
1179096705 21:38322584-38322606 TCTAAAACAAAGATGGCGCTGGG - Intergenic
1179160530 21:38893273-38893295 TCTTTGACAAAAATGCTGCATGG - Intergenic
1183436007 22:37795662-37795684 ACAGAAACAAAGATGGCGCATGG - Intergenic
951034548 3:17918892-17918914 TATTAAGCAAGGATGGTGAATGG - Intronic
953474684 3:43195359-43195381 TCTCAAACAAGCCTGGTGCAGGG + Intergenic
955677604 3:61465007-61465029 TCTAAAACAAAGATAGGGCAGGG - Intergenic
961301813 3:125926685-125926707 TTTTAAACAAAAATGGGGCTGGG - Intergenic
961886654 3:130101153-130101175 TTTTAAACAAAAATGGGGCTGGG + Intronic
961937630 3:130602349-130602371 TCCTATTCAAAGATGGTGAATGG + Intronic
962800774 3:138888648-138888670 TCTACAACATAGATTGTGCATGG - Intergenic
963797599 3:149646639-149646661 TCTTATACAAGGCTGATGCATGG - Intronic
968423204 4:502533-502555 TTTAAAACAAAGCTGCTGCAGGG - Intronic
968995821 4:3945170-3945192 TTTTAAACAAAAATGGGGCTGGG + Intergenic
970436904 4:16044525-16044547 TCTTAAACACACATAGTTCAGGG + Intronic
970890764 4:21041970-21041992 TCTTGTACAAGGATGCTGCAAGG + Intronic
971235201 4:24835225-24835247 TTTTAAATAAAGGTGGTGCATGG + Intronic
974066501 4:57082400-57082422 TCTTAGACTAAGATGATACAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976590195 4:86842386-86842408 TCTCAAACAAAGATAGTGGGAGG + Intronic
980416660 4:132497146-132497168 TCTGAGACAAACATGGTGAAGGG + Intergenic
981432305 4:144675600-144675622 TCCTAAACAAAAATAGTTCATGG + Intronic
982306171 4:153933557-153933579 TCTTATACAAAGATGGGCGAGGG + Intergenic
983050834 4:163045560-163045582 TCTAAAACCAAGATGTTGGAGGG + Intergenic
986774966 5:11006113-11006135 TCCCAAACAAGGATGTTGCAGGG + Intronic
987416601 5:17669179-17669201 ACTAAAACACAGAAGGTGCAGGG + Intergenic
990680657 5:58240299-58240321 TCTTAAACAAACTTGGTCCTTGG - Intergenic
990725507 5:58749233-58749255 TATGAAAGAAAGATGGTGAAGGG - Intronic
990817821 5:59805367-59805389 TCTTAAATAATGATGGTGTCAGG + Intronic
991134148 5:63161625-63161647 TCTTAACCACAAATGGTACAGGG + Intergenic
992952585 5:81875003-81875025 ACTTAAATAAAGAGGGTGGATGG + Intergenic
993872615 5:93269856-93269878 TCTTAAAAAAAGATTGTGCATGG - Intergenic
995467992 5:112470502-112470524 TCATAACCAAACATGGTGCTTGG + Intergenic
998933577 5:147208965-147208987 TATCAAACAAAGATGGAACATGG - Intergenic
1003306490 6:4933615-4933637 TTTTAAACAAAGATGGGAGAAGG + Intronic
1007173859 6:39883241-39883263 TCCTACACAGAGATGGGGCAAGG + Intronic
1009545854 6:65019602-65019624 TCTTAAATTAATATGGTGCTTGG - Intronic
1010106759 6:72179615-72179637 TCTTAACCAAATCTGGGGCATGG + Exonic
1010489534 6:76458714-76458736 TTTAAAAAAAAGATGGTTCATGG - Intergenic
1011408678 6:87043172-87043194 TCTTAAATAAAGATGGATTAAGG - Intergenic
1013353833 6:109330399-109330421 TCATAAACAAACATGGTACTGGG + Intergenic
1017115416 6:150971598-150971620 TTTTAAAAAAATATAGTGCATGG + Intronic
1017912861 6:158809504-158809526 TTTTAAACAAAGCTGGTGTTTGG - Intronic
1018058086 6:160069506-160069528 TCTTGAATAAAGAAGGTGCATGG + Intronic
1020222085 7:6246957-6246979 TCTTAAACAAAACTTGTTCATGG - Intronic
1020980932 7:15068011-15068033 TTTTAAAAAAAGGTGCTGCATGG + Intergenic
1022244402 7:28544405-28544427 TATTAAAAAGAGATGGTGCCAGG - Intronic
1023183280 7:37508054-37508076 AATTAAACAGAGATAGTGCAAGG + Intergenic
1024759185 7:52573551-52573573 TCTTAGACAAGTATGGGGCAGGG + Intergenic
1026093149 7:67317964-67317986 TCTTAAAAAAAGAGGAGGCATGG + Intergenic
1027035699 7:74923619-74923641 TCTTAAAAAAAGAGGAGGCATGG - Intergenic
1028798507 7:94932720-94932742 TCATTTACAAAGATGGTGCTGGG + Intronic
1029926523 7:104325221-104325243 AGTTAGACAAAGATGGTGCTAGG + Intergenic
1031201579 7:118694905-118694927 CCTTAAAAAAACAAGGTGCATGG - Intergenic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1034909496 7:154982869-154982891 TCTTAAAAAAAAATGGTGACGGG + Intronic
1034910549 7:154994521-154994543 TTTTATGCAGAGATGGTGCAAGG + Intronic
1038499563 8:28032250-28032272 GCTTAAAGAAAGGTGGGGCAGGG + Intronic
1038620656 8:29139761-29139783 TCTTATAAAAAGAAGGTGCTGGG - Intronic
1038775020 8:30521477-30521499 TTGTCAACAAAGATGGTGCCTGG + Intronic
1041206688 8:55506539-55506561 TCTTAAACAAAGATGGTGCAAGG - Intronic
1041389641 8:57337265-57337287 GGTTAAATAATGATGGTGCATGG - Intergenic
1045013332 8:97977531-97977553 GCTTAAACCAGGATGTTGCAGGG - Intronic
1045022295 8:98054202-98054224 TCTTATTCTAAGATGGTGCCTGG - Intergenic
1045528330 8:102960491-102960513 TTTGCAACAAAGATGGTGGATGG + Intronic
1046156090 8:110291792-110291814 TCAGAAACAAAGATGGGGCCAGG - Intergenic
1047131579 8:122026594-122026616 TCTTAAACACATCTGGTGCTGGG + Intergenic
1054789514 9:69242595-69242617 TCTTCAGGATAGATGGTGCAGGG + Intronic
1054914545 9:70483749-70483771 GCTTAAACAATCATGGTGGAAGG - Intergenic
1059275660 9:113094780-113094802 AATTAAACAAGGATGGTGCAGGG + Intergenic
1187174706 X:16885782-16885804 TCTTAGACAAAGTTGGGGGATGG + Intergenic
1188241070 X:27791384-27791406 TTTTAAATAATGATGATGCAGGG + Intergenic
1189673315 X:43435760-43435782 TCTAAAATCAAGATGGTTCATGG - Intergenic
1192735774 X:73848340-73848362 TGTAAAGCAAAGATGATGCAGGG + Intergenic
1193359613 X:80565224-80565246 CCTTAAAAAAAAATGGTGCAGGG + Intergenic
1195269156 X:103214206-103214228 TCTTAAACAAAAAAGGGGCCGGG + Intergenic
1195937601 X:110140423-110140445 TCTTAAAGAAAAAAGGTGAAGGG + Intronic
1197197149 X:123714057-123714079 TCTTAAACAAACAAATTGCAAGG + Intronic
1197675631 X:129326940-129326962 TCTTAACCAAAGAGGGTGGTAGG - Intergenic
1198392621 X:136191498-136191520 TCTGAACCTAACATGGTGCACGG - Intronic
1198591824 X:138191747-138191769 TCTTAAAGAAAGCAGGTGAAAGG + Intergenic
1200169748 X:154063986-154064008 TCTGAAATCAAGATGTTGCAGGG - Intronic
1200582696 Y:4969702-4969724 ACAGAAACAAAGATGGAGCAAGG + Intergenic