ID: 1041208144

View in Genome Browser
Species Human (GRCh38)
Location 8:55519341-55519363
Sequence ACGATTCCTTCAGTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041208144 Original CRISPR ACGATTCCTTCAGTGGCCCC AGG (reversed) Intronic
900154481 1:1198473-1198495 AACCTTCCTGCAGTGGCCCCAGG + Intergenic
907807470 1:57835955-57835977 ACTATTCCTTCATTTGCCTCGGG - Intronic
910430570 1:87155844-87155866 ACGATTTCCTCAGTGGCGCCAGG - Intronic
911733841 1:101316075-101316097 ACCGTTGCTTCAGTGGCCCTTGG + Intergenic
915513733 1:156400939-156400961 CCTCTTCCTCCAGTGGCCCCTGG - Intergenic
917794441 1:178522327-178522349 AACATTCCTTCAGAGGCCTCAGG + Exonic
1062913291 10:1228447-1228469 ACGGGTCCTTTAGTGGCCCTGGG - Intronic
1067770354 10:49118170-49118192 AAGATTCTTTCAGTGGCAACTGG - Intergenic
1069537728 10:69267329-69267351 ATGATTCCTGCAGTGCTCCCTGG - Exonic
1071201355 10:83222928-83222950 CAGATGCCTTCAGTCGCCCCAGG + Intergenic
1075264593 10:120989784-120989806 CAGATGCCTTCAGTTGCCCCAGG - Intergenic
1076317849 10:129555395-129555417 ACAATTTCTTGAGTGCCCCCTGG - Intronic
1077275989 11:1708786-1708808 GTGAGCCCTTCAGTGGCCCCAGG + Intergenic
1077712509 11:4551240-4551262 AAGATGCCTTCAGTTGCCTCAGG - Intergenic
1078356223 11:10633656-10633678 ACAAGTCCTTCTGGGGCCCCTGG + Intronic
1079898279 11:26149362-26149384 TAGATGCCTTCAGTTGCCCCGGG + Intergenic
1082833136 11:57634176-57634198 ACTATTCATTCAGCTGCCCCAGG - Intergenic
1087595280 11:100245791-100245813 AACATTCCTTAAGTGGCTCCGGG - Intronic
1089155934 11:116402602-116402624 ATGATCTCTTCATTGGCCCCAGG - Intergenic
1097732322 12:63142912-63142934 AAGAATCATTCAGTTGCCCCAGG + Exonic
1102214087 12:111147842-111147864 ACGAGTCCTCCAGGGGGCCCAGG + Intronic
1105424585 13:20283625-20283647 CAGATACCTTCAGTTGCCCCAGG - Intergenic
1113547404 13:111164757-111164779 ACGATTGCATCCGTGACCCCAGG + Intronic
1121504206 14:94463942-94463964 AGGTCCCCTTCAGTGGCCCCAGG + Intronic
1122641825 14:103164545-103164567 CAGATGCCTTCAGTGGCCCCAGG - Intergenic
1125487037 15:40118643-40118665 TTGGCTCCTTCAGTGGCCCCTGG - Intergenic
1125959470 15:43817273-43817295 AGGATTCATCCAGTGACCCCCGG - Exonic
1126418519 15:48445315-48445337 ATGATTCCTTGAGTGGTCTCTGG + Intronic
1130275857 15:82476059-82476081 AGGGTCCCTTCAGTGGACCCTGG + Intergenic
1130468216 15:84203451-84203473 AGGGTCCCTTCAGTGGACCCTGG + Intergenic
1130496048 15:84470091-84470113 AGGGTCCCTTCAGTGGACCCTGG - Intergenic
1130590509 15:85208049-85208071 AGGGTCCCTTCAGTGGACCCTGG + Intergenic
1132981403 16:2740193-2740215 ACCATTTCTTCTGTGGCCCAGGG + Intergenic
1133109140 16:3535248-3535270 ACGACTGCTTCAGTTCCCCCGGG - Intronic
1137587279 16:49671172-49671194 ACCATTTCTTCTGTGCCCCCTGG - Intronic
1137819680 16:51431981-51432003 ACAAATCCTTCAGTTGCGCCTGG - Intergenic
1138087477 16:54145958-54145980 GCGATGCTTTCTGTGGCCCCTGG - Intergenic
1145108988 17:20145166-20145188 ACGAGTGCTTCAGTGGCAACAGG + Intronic
1146212449 17:30953034-30953056 AGGATTCCTTCAGTAACCCCAGG - Intronic
1146886628 17:36475125-36475147 CAGATGCCTTCAGTTGCCCCAGG + Intergenic
1150273561 17:63881948-63881970 ACAAGCCCGTCAGTGGCCCCAGG - Intergenic
1151469565 17:74309674-74309696 CCGATTCCTTCAGAGCCCCTGGG + Intronic
1155233371 18:23795312-23795334 GCCCTTCATTCAGTGGCCCCAGG - Intronic
1162353026 19:10162901-10162923 ACGAGGCCTTCAGAGGCCCCAGG + Intronic
1164143179 19:22492643-22492665 ATGATGTCTTCAGTTGCCCCAGG - Intronic
1165261724 19:34624698-34624720 CAGATGCCTTCAGTTGCCCCAGG + Intronic
1165446772 19:35860963-35860985 ACGCTTCCTTCAGCTGCGCCTGG + Exonic
1167511239 19:49896325-49896347 CCCATTCCTTCAGAGTCCCCTGG + Intronic
930555716 2:52893993-52894015 GTGATTCCTTCAGTGGCTCAGGG + Intergenic
935181315 2:100693293-100693315 ACCATTCCTCCAGTGACCACTGG + Intergenic
939813346 2:146863955-146863977 ACGATCCCTACAGTGTACCCTGG + Intergenic
942095674 2:172534744-172534766 TGGATGCCTTCAGTTGCCCCAGG - Intergenic
942163360 2:173215944-173215966 AGGATTGCCTCAGTGGCACCTGG + Intronic
942172268 2:173299884-173299906 CAGATGCCTTCAGTTGCCCCAGG + Intergenic
942373207 2:175308525-175308547 ATGATTACTTCAGTGTGCCCAGG + Intergenic
942546031 2:177064572-177064594 ACGATGCCTTCTCTTGCCCCTGG + Intergenic
942573325 2:177336216-177336238 ACTATTCCTTCAGTGGTCCTTGG + Intronic
943854786 2:192775468-192775490 ATGAGGCCTGCAGTGGCCCCAGG - Intergenic
1177513534 21:22120580-22120602 AAGATGCCTTCAGTTGCCCCGGG + Intergenic
1177993874 21:28071999-28072021 ACGGTTCAGTCCGTGGCCCCAGG + Intergenic
1182571643 22:31243694-31243716 AGGATTCCTGCAGTTGCCTCTGG + Intronic
1182708525 22:32305790-32305812 GGCATGCCTTCAGTGGCCCCTGG - Intergenic
1183054326 22:35293719-35293741 CAGATTCCTTCAGTGGCCTCTGG + Exonic
1183418675 22:37697508-37697530 ACTGGTCCTTCCGTGGCCCCAGG - Intronic
1183743020 22:39678781-39678803 GGGCTTCCTTCAGGGGCCCCTGG - Intronic
1184092552 22:42300090-42300112 AAAATTCCTTCAGCAGCCCCAGG - Intronic
953772980 3:45792881-45792903 AGGGTTGCTTCTGTGGCCCCAGG - Intronic
958019462 3:87979247-87979269 CAGATACCTTCAGTTGCCCCAGG + Intergenic
959059313 3:101601670-101601692 TCAATTCCTTCAGTGACCCGTGG + Intergenic
961343633 3:126246937-126246959 AAGATGCCTTCAGTTGCCCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962891429 3:139676498-139676520 ACCATACCTTCAGGGGCTCCTGG + Intronic
966402158 3:179558990-179559012 AGAATTTCTTCTGTGGCCCCAGG - Intergenic
970707186 4:18818390-18818412 ACCATTTCTTCAGTTACCCCAGG - Intergenic
971514683 4:27471493-27471515 ACGATTCCTTCTTTAGCTCCTGG + Intergenic
972650134 4:41009200-41009222 ACAGTTCCCTCAGTGGCCCCAGG - Intronic
972841224 4:42932273-42932295 CGGATTCCTTCCTTGGCCCCTGG + Intronic
974617292 4:64306344-64306366 CAGATACCTTCAGTTGCCCCAGG - Intronic
975381474 4:73705225-73705247 ACTATTCCTTCAGTGAACCATGG - Intergenic
976654248 4:87471015-87471037 ACCTTTGCTTCAGTGGCCCTTGG + Intergenic
979192547 4:117879831-117879853 AAGTTTCCTTCAGTTACCCCTGG - Intergenic
982076908 4:151746938-151746960 ACCATTACTTCTGCGGCCCCAGG - Intronic
990492402 5:56315213-56315235 ACTCTTCCCTCAGTGGCCCTGGG + Intergenic
991159359 5:63478563-63478585 ATGATTCCTTCAGTGTTCCGTGG - Intergenic
991534635 5:67654449-67654471 ACCATTCCTCCAGAGGGCCCTGG - Intergenic
994052128 5:95374282-95374304 ACATTTCCTTGAGTGGCGCCTGG + Intergenic
994326208 5:98448530-98448552 ACGCTGACTTCAGTGGCCCTGGG + Intergenic
994774228 5:104024322-104024344 CAGATGCCTTCAGTTGCCCCAGG - Intergenic
995898734 5:117045133-117045155 AAGATTCTTTCAGTGTACCCAGG - Intergenic
997697990 5:135876844-135876866 AGGATTCCTCCAGTGCCCCAGGG + Intronic
1000145434 5:158449020-158449042 AGGTTTCCTGCAGTGGACCCAGG - Intergenic
1003302654 6:4898285-4898307 AGGTTTCCTGCTGTGGCCCCAGG - Intronic
1003476743 6:6490615-6490637 ACGCTTCCTCCAGTGGCTCCAGG - Intergenic
1006071173 6:31498876-31498898 ACCAGTCCTTCTGAGGCCCCTGG + Intronic
1007791808 6:44313380-44313402 GCGTTTCCTACAGCGGCCCCTGG + Intronic
1012263122 6:97111121-97111143 CAGATGCCTTCAGTTGCCCCAGG + Intronic
1012589629 6:100964926-100964948 ATGAGTCCTACACTGGCCCCAGG - Intergenic
1013052695 6:106552182-106552204 AGGATTCTTTCACTGGCCCAAGG + Exonic
1016120941 6:140340484-140340506 CAGATACCTTCAGTTGCCCCAGG + Intergenic
1017377346 6:153786635-153786657 ACTCTCCCTTCAGTGGCTCCAGG - Intergenic
1019076785 6:169394333-169394355 CAGATGCCTTCAGTTGCCCCAGG + Intergenic
1030386621 7:108874667-108874689 AAGATACCTTCAGTAGCCCCAGG - Intergenic
1034230960 7:149528141-149528163 AAGAAACCTTCAGTTGCCCCAGG - Intergenic
1036108926 8:5876485-5876507 AGGATTCCTTCAGCATCCCCAGG + Intergenic
1036134830 8:6151219-6151241 ATGATTCCTTCTGTGGCCAGTGG - Intergenic
1041208144 8:55519341-55519363 ACGATTCCTTCAGTGGCCCCAGG - Intronic
1041596225 8:59656600-59656622 ACGATTCCTAAAGTGGTCCAGGG + Intergenic
1042144182 8:65711143-65711165 ATGATTTCTCCAGTGGTCCCTGG + Intronic
1043347545 8:79317330-79317352 AGGTTGCCTTCAGTGGACCCAGG + Intergenic
1045052957 8:98343340-98343362 ACAAATGCTTCAGTGGCACCTGG - Intergenic
1046078990 8:109347577-109347599 AACATTCATTCAGTGGCCACAGG - Intergenic
1052126813 9:24786410-24786432 TCTATTCCTTCAGTTGCTCCTGG + Intergenic
1053308406 9:37000123-37000145 TGGATTCCTGCAGTGGCCCTAGG - Intronic
1056431504 9:86532907-86532929 AGGAATCCTTCAGTGGCTCCTGG - Intergenic
1056526599 9:87448257-87448279 ACGATTCATTCAAGGTCCCCAGG - Intergenic
1190453385 X:50602772-50602794 TCGCCTCCTTCAGGGGCCCCAGG - Exonic
1193348667 X:80432295-80432317 CAGATACCTTCAGTTGCCCCAGG + Intronic
1195853958 X:109310587-109310609 GAGATACCTTCAGTTGCCCCAGG + Intergenic