ID: 1041208256

View in Genome Browser
Species Human (GRCh38)
Location 8:55520734-55520756
Sequence CTGTAGCCGTAGAAAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041208256_1041208257 -1 Left 1041208256 8:55520734-55520756 CCTTCATTTTTCTACGGCTACAG 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1041208257 8:55520756-55520778 GTATCATCTTAACAAGTTCCTGG No data
1041208256_1041208258 14 Left 1041208256 8:55520734-55520756 CCTTCATTTTTCTACGGCTACAG 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1041208258 8:55520771-55520793 GTTCCTGGAGTGTCAAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041208256 Original CRISPR CTGTAGCCGTAGAAAAATGA AGG (reversed) Intronic
900879455 1:5370204-5370226 CTGTGGCTGGAGAGAAATGAAGG - Intergenic
902131870 1:14268878-14268900 CTGTACTCTTTGAAAAATGATGG - Intergenic
903076485 1:20771838-20771860 CTGTGGCAGTACAAAATTGATGG - Intronic
909499848 1:76321737-76321759 CTTTTGTGGTAGAAAAATGAAGG + Intronic
909558871 1:76986824-76986846 CTGCAGCCATAAAAAAATAAAGG + Intronic
910599321 1:89013645-89013667 CTGCAGCCTAAGACAAATGATGG - Intronic
913251130 1:116912554-116912576 CAGTAGCCGTAGAAACAGGAAGG - Intronic
913976033 1:143456349-143456371 TTGCAGCCATAAAAAAATGAAGG + Intergenic
914070430 1:144281967-144281989 TTGCAGCCATAAAAAAATGAAGG + Intergenic
914108725 1:144684387-144684409 TTGCAGCCATAAAAAAATGAAGG - Intergenic
916718654 1:167465828-167465850 CTGTAGCCAGAGAAATATGGAGG - Intronic
917096078 1:171400086-171400108 CTATTGCAGTAGAGAAATGATGG + Intergenic
919361855 1:196606600-196606622 CAGCATCCTTAGAAAAATGAGGG + Intronic
924668716 1:246101247-246101269 CTTTAGCCCTAGGAAAATAAAGG - Intronic
1064490113 10:15846607-15846629 CTGTAGAGGAAGAAAAATTATGG - Intronic
1066556244 10:36617371-36617393 TTGTATCAGTACAAAAATGAAGG + Intergenic
1071548789 10:86549850-86549872 CTGAACCTGTAGAAACATGATGG - Intergenic
1076473296 10:130735201-130735223 CAGTAGCTGCAGAAAAAAGAGGG + Intergenic
1076588287 10:131565682-131565704 CTGTAGAACTAGGAAAATGAGGG + Intergenic
1078313391 11:10269424-10269446 CTGGAACCGTAGAGAAAAGAAGG + Intronic
1081247372 11:40785277-40785299 CTGTAACTATAGAAAAATGATGG - Intronic
1091819689 12:3466512-3466534 CTCTAGCCCAAGAAAAATGGAGG + Intronic
1092907313 12:13113512-13113534 CTGTTACCTTAGAAAGATGATGG + Intronic
1097549117 12:61044779-61044801 CTGTTGACATAGAAAATTGAAGG - Intergenic
1101693482 12:107102807-107102829 GTTTAGCTCTAGAAAAATGAAGG + Intergenic
1104690220 12:130819783-130819805 CAGTACCCGTAGAATAATCAAGG - Intronic
1105223209 13:18353405-18353427 TTGCAGCCATAAAAAAATGAAGG - Intergenic
1105663926 13:22530960-22530982 CTGGAGCCCTAGTAAAATGTGGG + Intergenic
1107347826 13:39481900-39481922 CTGGAGCAGTAGAGAGATGATGG + Intronic
1109678616 13:65715970-65715992 CTGTAAACTTAGAAAAATAAGGG + Intergenic
1111504097 13:89163440-89163462 CTGCTGCCATAGAGAAATGAAGG + Intergenic
1116838441 14:49794695-49794717 CTGTAGCAGTATAAAAATGAGGG - Intronic
1118619682 14:67603190-67603212 CTGTAGCCCTAGATACTTGAGGG - Intergenic
1118759873 14:68873876-68873898 TTGGTGCCGTGGAAAAATGAAGG + Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1125390031 15:39182268-39182290 CTTTCCCCGTACAAAAATGAAGG + Intergenic
1126269052 15:46791313-46791335 CTGCAGCAGCAGGAAAATGACGG + Intergenic
1128746322 15:70116938-70116960 CAGTAGGCACAGAAAAATGATGG + Intergenic
1132941358 16:2510023-2510045 CAGAAGCCGTAGAGAAATGTAGG - Intronic
1135256911 16:20948416-20948438 CTGTAGCCATATAGAGATGACGG + Intronic
1138733149 16:59218538-59218560 CTGTCACCTAAGAAAAATGATGG + Intergenic
1141331927 16:83118632-83118654 CAGAAACGGTAGAAAAATGAAGG - Intronic
1142292253 16:89198551-89198573 CTGTAGCCGCAGAGATGTGAGGG + Intronic
1145986514 17:29050712-29050734 CTGTAGCCCTAGAAACTTGGAGG + Intronic
1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG + Intergenic
1151912486 17:77093050-77093072 CTGTAGACTTGGAAGAATGAGGG + Intronic
1152866375 17:82726216-82726238 CTGTAGCCTTCCAAGAATGAAGG - Intronic
1165136924 19:33675360-33675382 CTGTAGCCATTGAACCATGAAGG + Intronic
930362727 2:50402147-50402169 CTGTAGCAGAAGAAAAATAAAGG + Intronic
931528826 2:63189476-63189498 TTGTCTCCATAGAAAAATGAGGG + Intronic
932956281 2:76355247-76355269 CTGTAGCCATATATAAAGGAAGG - Intergenic
932972010 2:76555277-76555299 CTGTACCCATAGAAATATCATGG + Intergenic
933405095 2:81847889-81847911 CTATTGTCATAGAAAAATGAGGG - Intergenic
934180731 2:89617330-89617352 TTGCAGCCATAAAAAAATGAAGG + Intergenic
934291031 2:91691578-91691600 TTGCAGCCATAAAAAAATGAAGG + Intergenic
938487572 2:131727471-131727493 GTGTAGTCATTGAAAAATGAAGG - Intronic
941024890 2:160447626-160447648 TTCTAGCAGTATAAAAATGAAGG - Intronic
945572940 2:211493169-211493191 CTGTAACTGTAGAAATTTGAAGG - Intronic
948499410 2:238380884-238380906 CTGTAGCCATAAAACAAAGATGG + Intronic
1176731759 21:10505823-10505845 TTGCAGCCATAAAAAAATGAAGG - Intergenic
1176954403 21:15084648-15084670 TTCTCACCGTAGAAAAATGAGGG - Intergenic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1183123274 22:35748999-35749021 CTGTAGGCCTAGGAAAATGAGGG - Intronic
1185210451 22:49567976-49567998 CTGTGGCCGTGGAAAGCTGAAGG + Intronic
1185281177 22:49970583-49970605 CTGTACACGTAGAAAAGTGTCGG + Intergenic
950795318 3:15505846-15505868 CTGTCACCATGGAAAAATGAAGG - Intronic
954472778 3:50712774-50712796 CTGTAACAGTAGGAAAATTAGGG - Intronic
962444789 3:135454770-135454792 ATATAGCAGTAGAAAAATGAAGG + Intergenic
964194562 3:154047663-154047685 CTCTAGCAGTAGAAAAGGGAAGG - Intergenic
969360339 4:6659178-6659200 CTTTAGCAGTAGAACAATAAAGG + Intergenic
978165692 4:105603787-105603809 CTGTGGCAGTAGGAAAGTGATGG - Intronic
981004052 4:139856945-139856967 TTGTAGGAGTAAAAAAATGAAGG + Intronic
982537707 4:156627342-156627364 CTGTTGCCATAGAAAGATGGAGG + Intergenic
983213440 4:164980582-164980604 CTGCAGCCATAAAAAAATGAGGG + Intergenic
986824489 5:11505869-11505891 CAGGAACCATAGAAAAATGACGG - Intronic
988638660 5:33016642-33016664 CTACAGCGATAGAAAAATGATGG + Intergenic
988969864 5:36456617-36456639 GTGTAGTGATAGAAAAATGACGG + Intergenic
991361910 5:65829663-65829685 CTCTATCCCTAGAAAAATGCAGG - Intronic
993149257 5:84139276-84139298 CTGAACCTGTACAAAAATGAAGG + Intronic
994587867 5:101734006-101734028 CAGTAGCCAGAGAAAAATCAGGG - Intergenic
998503831 5:142656209-142656231 CTCTAGCCATAGAAAATGGATGG + Intronic
1000495428 5:161977317-161977339 CTCTATCCGTAGAGAAATGTAGG + Intergenic
1002372673 5:178767642-178767664 GTGCAGCGTTAGAAAAATGAAGG - Intergenic
1005976566 6:30804547-30804569 CTGTAGTTGTAGAAAAGTGCAGG + Intergenic
1007868375 6:45002255-45002277 CTGTAGACCTAGAAAACTGGGGG - Intronic
1008415080 6:51230151-51230173 ATGCAGCCATAAAAAAATGAAGG + Intergenic
1008869472 6:56255563-56255585 TTGTAGCCACAGAAAAATGTTGG - Intronic
1012990605 6:105922131-105922153 CTGTAGCCACAGAAAAGTCAAGG + Intergenic
1014320812 6:119925889-119925911 CTGTAGGAGAAGAAAAATTAGGG - Intergenic
1015125859 6:129753662-129753684 CTGAAGCCTTAGAGAAATTAAGG + Intergenic
1017944604 6:159084566-159084588 CTGTAGCTGAAAAAAAATTAAGG + Intergenic
1018053837 6:160035103-160035125 TTGTAGCTGTAGAGAGATGATGG + Intronic
1030450929 7:109710024-109710046 CTATAAACTTAGAAAAATGATGG - Intergenic
1031726347 7:125244449-125244471 CTGTACCAGTAAAAATATGAAGG - Intergenic
1031775057 7:125898552-125898574 GTGAAGAAGTAGAAAAATGATGG + Intergenic
1034597831 7:152215622-152215644 TTGCAGCCATAAAAAAATGAAGG + Intronic
1035877784 8:3210777-3210799 CTTTAGCCATAGAAAAAGCATGG - Intronic
1041208256 8:55520734-55520756 CTGTAGCCGTAGAAAAATGAAGG - Intronic
1041631302 8:60090653-60090675 TTGTACACTTAGAAAAATGAAGG + Intergenic
1042644363 8:70969628-70969650 TTTTAGCCATGGAAAAATGAGGG - Intergenic
1043293680 8:78637311-78637333 CTGTAGTCTAAAAAAAATGATGG - Intergenic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1050860302 9:10420893-10420915 CTGTAACAGTAGCAAAATGTGGG - Intronic
1053674544 9:40410884-40410906 TTGTAGCGGTGGAAATATGAGGG - Intergenic
1053924336 9:43037248-43037270 TTGTAGCGGTGGAAATATGAGGG - Intergenic
1054385650 9:64550948-64550970 TTGTAGCGGTGGAAATATGAGGG - Intergenic
1054510076 9:65965407-65965429 TTGTAGCGGTGGAAATATGAGGG + Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055003678 9:71482206-71482228 CTGTAGCCAAAGCAAGATGATGG + Intergenic
1055106828 9:72522045-72522067 CTGTAGCAGTAGAAAAGTAGAGG - Intronic
1194590054 X:95789378-95789400 ATGTTTCAGTAGAAAAATGAAGG + Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic