ID: 1041224729

View in Genome Browser
Species Human (GRCh38)
Location 8:55687058-55687080
Sequence GAACCTACTGAGTCTAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041224729_1041224734 24 Left 1041224729 8:55687058-55687080 CCTTATCTAGACTCAGTAGGTTC No data
Right 1041224734 8:55687105-55687127 TTCCCTGAAATCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041224729 Original CRISPR GAACCTACTGAGTCTAGATA AGG (reversed) Intergenic
No off target data available for this crispr