ID: 1041224732 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:55687086-55687108 |
| Sequence | GGAAATAGAGATAAGGCCAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1041224732_1041224737 | 6 | Left | 1041224732 | 8:55687086-55687108 | CCAATGGCCTTATCTCTATTTCC | No data | ||
| Right | 1041224737 | 8:55687115-55687137 | TCTCTCTGCCTGGCCTCCTGTGG | No data | ||||
| 1041224732_1041224734 | -4 | Left | 1041224732 | 8:55687086-55687108 | CCAATGGCCTTATCTCTATTTCC | No data | ||
| Right | 1041224734 | 8:55687105-55687127 | TTCCCTGAAATCTCTCTGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1041224732 | Original CRISPR | GGAAATAGAGATAAGGCCAT TGG (reversed) | Intergenic | ||