ID: 1041224732

View in Genome Browser
Species Human (GRCh38)
Location 8:55687086-55687108
Sequence GGAAATAGAGATAAGGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041224732_1041224737 6 Left 1041224732 8:55687086-55687108 CCAATGGCCTTATCTCTATTTCC No data
Right 1041224737 8:55687115-55687137 TCTCTCTGCCTGGCCTCCTGTGG No data
1041224732_1041224734 -4 Left 1041224732 8:55687086-55687108 CCAATGGCCTTATCTCTATTTCC No data
Right 1041224734 8:55687105-55687127 TTCCCTGAAATCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041224732 Original CRISPR GGAAATAGAGATAAGGCCAT TGG (reversed) Intergenic