ID: 1041224732 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:55687086-55687108 |
Sequence | GGAAATAGAGATAAGGCCAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1041224732_1041224737 | 6 | Left | 1041224732 | 8:55687086-55687108 | CCAATGGCCTTATCTCTATTTCC | No data | ||
Right | 1041224737 | 8:55687115-55687137 | TCTCTCTGCCTGGCCTCCTGTGG | No data | ||||
1041224732_1041224734 | -4 | Left | 1041224732 | 8:55687086-55687108 | CCAATGGCCTTATCTCTATTTCC | No data | ||
Right | 1041224734 | 8:55687105-55687127 | TTCCCTGAAATCTCTCTGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1041224732 | Original CRISPR | GGAAATAGAGATAAGGCCAT TGG (reversed) | Intergenic | ||