ID: 1041224733

View in Genome Browser
Species Human (GRCh38)
Location 8:55687093-55687115
Sequence ATTTCAGGGAAATAGAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041224733_1041224743 26 Left 1041224733 8:55687093-55687115 CCTTATCTCTATTTCCCTGAAAT No data
Right 1041224743 8:55687142-55687164 GCAAGCTTCATCCCACGTTGGGG No data
1041224733_1041224737 -1 Left 1041224733 8:55687093-55687115 CCTTATCTCTATTTCCCTGAAAT No data
Right 1041224737 8:55687115-55687137 TCTCTCTGCCTGGCCTCCTGTGG No data
1041224733_1041224742 25 Left 1041224733 8:55687093-55687115 CCTTATCTCTATTTCCCTGAAAT No data
Right 1041224742 8:55687141-55687163 TGCAAGCTTCATCCCACGTTGGG No data
1041224733_1041224741 24 Left 1041224733 8:55687093-55687115 CCTTATCTCTATTTCCCTGAAAT No data
Right 1041224741 8:55687140-55687162 ATGCAAGCTTCATCCCACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041224733 Original CRISPR ATTTCAGGGAAATAGAGATA AGG (reversed) Intergenic
No off target data available for this crispr