ID: 1041224737

View in Genome Browser
Species Human (GRCh38)
Location 8:55687115-55687137
Sequence TCTCTCTGCCTGGCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041224733_1041224737 -1 Left 1041224733 8:55687093-55687115 CCTTATCTCTATTTCCCTGAAAT No data
Right 1041224737 8:55687115-55687137 TCTCTCTGCCTGGCCTCCTGTGG No data
1041224732_1041224737 6 Left 1041224732 8:55687086-55687108 CCAATGGCCTTATCTCTATTTCC No data
Right 1041224737 8:55687115-55687137 TCTCTCTGCCTGGCCTCCTGTGG No data
1041224731_1041224737 7 Left 1041224731 8:55687085-55687107 CCCAATGGCCTTATCTCTATTTC No data
Right 1041224737 8:55687115-55687137 TCTCTCTGCCTGGCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041224737 Original CRISPR TCTCTCTGCCTGGCCTCCTG TGG Intergenic
No off target data available for this crispr