ID: 1041226968

View in Genome Browser
Species Human (GRCh38)
Location 8:55709989-55710011
Sequence AAGTTAATTTAGACAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041226966_1041226968 -6 Left 1041226966 8:55709972-55709994 CCATCTATACCAATTCTAAGTTA 0: 127
1: 80
2: 44
3: 19
4: 175
Right 1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG No data
1041226964_1041226968 20 Left 1041226964 8:55709946-55709968 CCCAGGTAATTGAAGGGGAAAAA 0: 1
1: 2
2: 15
3: 71
4: 465
Right 1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG No data
1041226965_1041226968 19 Left 1041226965 8:55709947-55709969 CCAGGTAATTGAAGGGGAAAAAA 0: 1
1: 3
2: 16
3: 50
4: 427
Right 1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG No data
1041226963_1041226968 23 Left 1041226963 8:55709943-55709965 CCTCCCAGGTAATTGAAGGGGAA 0: 1
1: 1
2: 14
3: 36
4: 154
Right 1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041226968 Original CRISPR AAGTTAATTTAGACAAAACA AGG Intronic
No off target data available for this crispr