ID: 1041237913

View in Genome Browser
Species Human (GRCh38)
Location 8:55823379-55823401
Sequence TTTGATGCTAACTGTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041237903_1041237913 18 Left 1041237903 8:55823338-55823360 CCCATCCCCCTGTCAAATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237909_1041237913 10 Left 1041237909 8:55823346-55823368 CCTGTCAAATGCTGGTCATTTGG 0: 1
1: 0
2: 1
3: 16
4: 114
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237907_1041237913 12 Left 1041237907 8:55823344-55823366 CCCCTGTCAAATGCTGGTCATTT 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237906_1041237913 13 Left 1041237906 8:55823343-55823365 CCCCCTGTCAAATGCTGGTCATT 0: 1
1: 0
2: 2
3: 7
4: 169
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237908_1041237913 11 Left 1041237908 8:55823345-55823367 CCCTGTCAAATGCTGGTCATTTG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237905_1041237913 17 Left 1041237905 8:55823339-55823361 CCATCCCCCTGTCAAATGCTGGT 0: 1
1: 1
2: 0
3: 19
4: 155
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data
1041237902_1041237913 19 Left 1041237902 8:55823337-55823359 CCCCATCCCCCTGTCAAATGCTG 0: 1
1: 0
2: 0
3: 12
4: 239
Right 1041237913 8:55823379-55823401 TTTGATGCTAACTGTGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041237913 Original CRISPR TTTGATGCTAACTGTGGAAG TGG Intronic
No off target data available for this crispr