ID: 1041239369

View in Genome Browser
Species Human (GRCh38)
Location 8:55836127-55836149
Sequence GAGCCACAGTTGTTTCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041239369_1041239374 8 Left 1041239369 8:55836127-55836149 CCAGTTTGAAACAACTGTGGCTC No data
Right 1041239374 8:55836158-55836180 AGAACTGACTTTCACACAAAGGG No data
1041239369_1041239373 7 Left 1041239369 8:55836127-55836149 CCAGTTTGAAACAACTGTGGCTC No data
Right 1041239373 8:55836157-55836179 CAGAACTGACTTTCACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041239369 Original CRISPR GAGCCACAGTTGTTTCAAAC TGG (reversed) Intergenic
No off target data available for this crispr