ID: 1041245729

View in Genome Browser
Species Human (GRCh38)
Location 8:55886569-55886591
Sequence GGTAAAATGTTTCTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041245729_1041245733 24 Left 1041245729 8:55886569-55886591 CCCATAGCAAGAAACATTTTACC 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1041245733 8:55886616-55886638 AGGCAAAACAAAATAGAAAAAGG No data
1041245729_1041245732 4 Left 1041245729 8:55886569-55886591 CCCATAGCAAGAAACATTTTACC 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1041245732 8:55886596-55886618 GCTCAAATACACATATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041245729 Original CRISPR GGTAAAATGTTTCTTGCTAT GGG (reversed) Intronic
900968079 1:5973391-5973413 GGTTAGATATTTCTTGCTTTGGG - Intronic
906226379 1:44125779-44125801 ATTATAATGTTTCTTGGTATAGG + Intronic
907784936 1:57602482-57602504 GGAAAAATGTTTCTTGGTGAAGG + Intronic
908943447 1:69464934-69464956 GGAAAAATATTTCATGCTAATGG - Intergenic
908955164 1:69616545-69616567 TGTAAAATGTTTCTTTCCAATGG + Intronic
911744367 1:101423984-101424006 GGGAAAAAGTTCCTTGATATTGG + Intergenic
911765577 1:101670604-101670626 GGTACAATGTTTGTTTATATGGG - Intergenic
915075263 1:153303076-153303098 AATAAAATGTTTCTTGCTTTTGG - Intronic
917618614 1:176771771-176771793 GGAAAAGTGTTTCTTGCCATGGG - Intronic
920219805 1:204388652-204388674 AATAAAATGTTGCTGGCTATAGG + Intergenic
921506857 1:215982350-215982372 GTTAAAGTTTTACTTGCTATAGG + Intronic
922198874 1:223384042-223384064 CGTGAAATGTTTGTTTCTATGGG - Intergenic
923115065 1:230928689-230928711 GTTAAAATGATGTTTGCTATAGG + Intronic
924604386 1:245520439-245520461 CGTAAAATATTTCTTGGTATGGG - Intronic
1064873817 10:19970093-19970115 GGTAAAATTTCTCCTGGTATAGG - Intronic
1064917856 10:20481628-20481650 GGTAAAATGTTCCTTGACATTGG - Intergenic
1066356683 10:34691458-34691480 GGAAAAATGTTCCATGCTCTTGG + Intronic
1067239092 10:44475215-44475237 GGCCAAATGCTTGTTGCTATGGG - Intergenic
1067992641 10:51232511-51232533 TGTAAAATGTTTATTGTTATAGG - Intronic
1069746047 10:70715703-70715725 AGTGAGATGTTTCTTTCTATTGG + Intronic
1072033961 10:91547629-91547651 TGTAAAATGTTTCTTGGTGTAGG + Intergenic
1073556777 10:104461097-104461119 GGAAAAATGTTTCATGCTTACGG - Intergenic
1074995263 10:118751808-118751830 GGTACAATTTTCCTTGCTCTTGG - Intronic
1075821091 10:125312139-125312161 GGAAAAATGTTCCATGCTAATGG + Intergenic
1079682663 11:23317984-23318006 AGTAAAATATTTCTTTCAATGGG - Intergenic
1080158878 11:29146852-29146874 GGGGAAATGCTTCTTGATATTGG + Intergenic
1080956717 11:37105767-37105789 GGTAATATTTTTATTACTATGGG + Intergenic
1081272329 11:41100232-41100254 GGAAAAATGTTTCATGCTCATGG + Intronic
1083555478 11:63622766-63622788 GGGAAAAAGTTTCTTGTAATCGG - Intergenic
1087247654 11:95858509-95858531 GGTAAAATGTTTCCTGTCTTTGG - Exonic
1088187548 11:107188821-107188843 GGGAAAATGCTTCTTGACATTGG - Intergenic
1088311790 11:108467828-108467850 TGTAAAATTTTTCTTGAGATAGG + Intergenic
1088696119 11:112367397-112367419 GGGAAAATGTGTCTTGGAATTGG + Intergenic
1089476147 11:118764439-118764461 GGTACAAAGTTGTTTGCTATGGG - Intronic
1090447657 11:126777627-126777649 GGTAAAAAGTGACTTGCTTTGGG - Intronic
1093289665 12:17304278-17304300 GGTAAATGGTTTCCAGCTATAGG + Intergenic
1095143327 12:38693709-38693731 GATAAAATGTTTCCAGCTCTAGG - Exonic
1095333621 12:41000383-41000405 GTTAAAACTTTTCATGCTATAGG - Intronic
1097419410 12:59355663-59355685 GGAAAAATGTTTCATGCTTATGG - Intergenic
1098038132 12:66327120-66327142 GATAAAATGGTTCTTGCCAGGGG + Intronic
1098134837 12:67391233-67391255 GGTAAGATCTTGCTTGCTAGTGG - Intergenic
1098774308 12:74592079-74592101 GGTAAACTGTTAGTGGCTATGGG + Intergenic
1098928401 12:76379933-76379955 GGTCAAATGTTTTTTGACATGGG - Intronic
1099323853 12:81186271-81186293 GGGGAAATGTTTCTGGCTGTTGG + Intronic
1099737207 12:86585500-86585522 GGTAAAATGCTATTTGCAATGGG + Intronic
1100033234 12:90218865-90218887 GGTGAAATCTGTCTTGCTTTAGG + Intergenic
1101237948 12:102808688-102808710 GGAAGAATGTTTCGTGCCATGGG + Intergenic
1101566962 12:105916011-105916033 GGTTAAAAGCTTCTTGATATTGG - Intergenic
1104112829 12:125719640-125719662 GGTAAAATGTTTCCTAGCATCGG + Intergenic
1104510682 12:129374924-129374946 GGTGAAATATTTCTAGCTACAGG + Intronic
1104565442 12:129877078-129877100 TGTAAAATGTGTCTTGTTTTGGG - Intronic
1108031941 13:46240849-46240871 GGAAAAATGTTCCATGCTAATGG + Intronic
1109131519 13:58592360-58592382 GGTAACAAGTTTCCTGCTTTTGG - Intergenic
1109350532 13:61174839-61174861 TCTAAAATGTTTATTGCTAAAGG + Intergenic
1114785906 14:25598193-25598215 GAAAATATATTTCTTGCTATGGG - Intergenic
1115030928 14:28792943-28792965 GGTACAATGTTTCTTTATAATGG - Exonic
1116996101 14:51326871-51326893 AGTTCAATATTTCTTGCTATTGG + Intergenic
1117767379 14:59097094-59097116 GATAAAAAGTTTCTTTCTATCGG - Intergenic
1118013269 14:61631869-61631891 GGTTAAATATTTTTTTCTATGGG - Intronic
1118231153 14:63951030-63951052 AGAAAAATGTTTTTTGCTCTTGG + Intronic
1118618812 14:67596058-67596080 GTTAAAATGTGTTTTCCTATTGG + Intronic
1120423787 14:84321463-84321485 GGGAAAATATTTCTGGATATTGG + Intergenic
1120698077 14:87666565-87666587 GGTTCAATATTTCTTTCTATGGG - Intergenic
1121148593 14:91608304-91608326 TGAAACATGTTTCTTGGTATGGG + Exonic
1124965354 15:34429242-34429264 GGTAAAATATGTGTTGTTATTGG + Intronic
1124981972 15:34575444-34575466 GGTAAAATATGTGTTGTTATTGG + Intronic
1124991545 15:34679172-34679194 GGAAAATTATTTCTTGCTGTAGG + Intergenic
1125050504 15:35293071-35293093 TGTAGAATATTTCTTGCTAATGG - Intronic
1125068732 15:35525832-35525854 GGAAAAATGTTTTTTGAGATAGG - Intronic
1126586669 15:50295462-50295484 GTTTAAATGTTTCTTCCTCTAGG + Intronic
1127034746 15:54903220-54903242 GGAAAAATGTTTCATGCTCATGG - Intergenic
1127181593 15:56425193-56425215 ATTAAAATGTGTCTTGCTGTGGG + Intronic
1128849527 15:70939077-70939099 GTAAATATGTTTCTTACTATGGG + Intronic
1130728955 15:86469922-86469944 GGTTACTTGTTTCTTGCTATTGG + Intronic
1138859234 16:60735301-60735323 GGTAGAATGTTCTTTGCCATTGG - Intergenic
1140570469 16:76100132-76100154 AGTAAAATGTTGGTTGCTACAGG - Intergenic
1142578992 17:929058-929080 GTTAAAATTTTTCTTGACATTGG - Intronic
1143281166 17:5755394-5755416 GGTACAATGTTCCTTGGTTTGGG + Intergenic
1144611360 17:16719896-16719918 GGTAACATGTTTTTTTCTTTTGG + Intronic
1144719460 17:17458063-17458085 GGTAAAAGATTTCTTTCAATTGG + Intergenic
1144901377 17:18595462-18595484 GGTAACATGTTTTTTTCTTTTGG - Intergenic
1146278844 17:31532064-31532086 GGTAAAATGATTCTACCTCTGGG + Exonic
1146563163 17:33889021-33889043 GTAAAAATGTTTCTTGGGATGGG + Intronic
1148326688 17:46787272-46787294 TGTGAAAGTTTTCTTGCTATTGG + Intronic
1148656567 17:49288189-49288211 GTAAAAATATTTCTTGCTATGGG + Intergenic
1149130897 17:53301098-53301120 AGGAAAATGTTCCTTGATATTGG + Intergenic
1152516211 17:80826329-80826351 GGAAACATGTTTCTTGCAAATGG - Intronic
1153175092 18:2363040-2363062 GCTAAAGTGTCTCTTGCTAAAGG + Intergenic
1153251530 18:3127153-3127175 GGAAAAATATTTCTTCTTATGGG - Intronic
1155884719 18:31193658-31193680 GGTACTAAGTTTCTTGCCATTGG + Intergenic
1158288670 18:55914167-55914189 AATAAAAAGTTTTTTGCTATGGG + Intergenic
1159443081 18:68506754-68506776 GGTGAAATGTATATTGCTAAAGG + Intergenic
925063140 2:908913-908935 GGTAAAATGTCATTTGCTAAAGG + Intergenic
925126999 2:1464978-1465000 GGAAAAATTCTTCTTGCTATTGG - Intronic
925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG + Intronic
925569248 2:5291548-5291570 GCTTAAATGTTTCTTGATATAGG + Intergenic
925643604 2:6011689-6011711 GTTACAATTTTTTTTGCTATGGG - Intergenic
927272289 2:21225104-21225126 GGAAGAATGTTTCCTGCTTTGGG - Intergenic
927566610 2:24119107-24119129 TGTAAAATGTCTCTTTATATAGG + Intronic
929907482 2:46058867-46058889 TTTAAAATTTTTGTTGCTATGGG + Intronic
931575324 2:63712422-63712444 GGAGAAATTATTCTTGCTATGGG - Intronic
932053059 2:68418019-68418041 GGTTAAAAGTTTCTTGTAATTGG + Intergenic
936590944 2:113803732-113803754 GATAAAATGTGTCTTTTTATGGG - Intergenic
936980502 2:118260726-118260748 GGTAATAAGTTTATTGCCATTGG + Intergenic
937874314 2:126809745-126809767 GGAAAAATGTTTGTTGTTAAAGG - Intergenic
939019233 2:136939382-136939404 GCTAACATGTTTCATGCTACTGG + Intronic
939212621 2:139196267-139196289 GGTAGAATCTTTCTGGCTAGAGG - Intergenic
942371197 2:175287132-175287154 GGAAAAATGTTTCTTTTTAAAGG + Intergenic
942694295 2:178622164-178622186 GGTAAGATTGTTCTTGCTTTTGG - Intronic
942704976 2:178761026-178761048 GGTAAAACTTTTCTTGGTAGTGG + Intronic
942933027 2:181519128-181519150 TGTAAAATGTTTCTTATCATTGG - Intronic
943915110 2:193622005-193622027 GGGAAAGTGTTTCATGCTGTAGG + Intergenic
945848542 2:214977984-214978006 GGTAAAATTCTTCTTGTAATCGG - Intronic
947039077 2:225894621-225894643 GATAAAATGTTGGTTTCTATGGG + Intergenic
1169360614 20:4945737-4945759 GGTAAAATGCTTCATGCTGTGGG + Intronic
1170232545 20:14066561-14066583 GGTCATATGTTTCTTACTGTGGG - Intronic
1170260615 20:14402752-14402774 GGAAGAAGGTTTCTTTCTATTGG - Intronic
1173109639 20:40174664-40174686 TCTAGAATTTTTCTTGCTATAGG + Intergenic
1174979499 20:55377416-55377438 AGCAACATGTTTCTTGATATTGG + Intergenic
1177228661 21:18290120-18290142 GGAACAATGTTTTTTGTTATTGG + Intronic
1178572723 21:33755442-33755464 TGTAAACTGTTTCTAGATATTGG + Intronic
1182163938 22:28152747-28152769 GGTAAAATGTTTCTAATTATAGG - Intronic
1185160168 22:49220438-49220460 GGTAAAATATTTAGTGCTAAGGG + Intergenic
949204850 3:1425644-1425666 AGTCAAATGTTTCTTCCTCTGGG - Intergenic
951568998 3:24042587-24042609 GGTTAAATGTTTATTTCTAAGGG - Intergenic
953279779 3:41543068-41543090 GGAAAAATATTACTTGCTTTGGG - Intronic
953798993 3:46007109-46007131 GGCAAAATGTTTCTTTATTTTGG + Intergenic
956151837 3:66251715-66251737 GGTACAATGTTCCTTTCTACAGG - Intronic
956460013 3:69462373-69462395 AGTGAACTGCTTCTTGCTATGGG - Intronic
957402730 3:79737235-79737257 GTTAAAATCATTCTTTCTATAGG - Intronic
957821388 3:85379142-85379164 GGTAATATTTTTGTTGCTTTTGG - Intronic
958711872 3:97726567-97726589 TGTGAAATGTTTCTGGCAATAGG - Intronic
958912932 3:100014969-100014991 GGGAAAAAGCTTCTTGATATTGG - Intronic
959407902 3:105983635-105983657 GGGAAAATGTTTCATGACATTGG - Intergenic
962675114 3:137750632-137750654 GATAAAATGTTACATGCTGTTGG + Intergenic
963284584 3:143421148-143421170 GGAAAAATATTTCATGCTAATGG + Intronic
964287804 3:155139180-155139202 GGAGAAATGTTTCCTGCTCTGGG + Intronic
964844757 3:161033206-161033228 GGAAAAATGTTTCATGCTCATGG + Intronic
965107100 3:164370777-164370799 TGTAAAATGTTTCTTATTATTGG + Intergenic
967653775 3:192020306-192020328 GGGAAAAAGTTTCTTGACATTGG + Intergenic
971195078 4:24465344-24465366 ATTAAAATGTTTCTTTCTTTCGG - Intergenic
974973303 4:68858484-68858506 GAAAAATTGTTTTTTGCTATAGG + Intergenic
975388707 4:73790110-73790132 GGTAAAATGGTTGTTGCCAAAGG - Intergenic
975941619 4:79654545-79654567 GGCTTAATGTTTCTTGCTGTTGG - Intergenic
976003015 4:80394502-80394524 GGTAAAAAGCTTCTTGATATTGG - Intronic
976290239 4:83410360-83410382 GTTAAAATGTTACTTGGTTTGGG - Intronic
977003714 4:91537752-91537774 GGTATATTGTTGATTGCTATGGG - Intronic
978541975 4:109826664-109826686 GGTATTATGTTTTTTGCTCTAGG + Intergenic
979004184 4:115268233-115268255 TGTAAAATGATTCTCCCTATAGG - Intergenic
979683574 4:123486948-123486970 GGTAAAATGGTTCCTTCTGTAGG + Intergenic
980147013 4:128999117-128999139 TGTAGAATGATTCTTGCTTTGGG + Intronic
980185454 4:129455598-129455620 GGGAAAATAATGCTTGCTATTGG + Intergenic
980505226 4:133710319-133710341 AGTAAAATGATTGTTGCTAAAGG - Intergenic
981101707 4:140836253-140836275 GGACAAATGTTTCATGCTATGGG - Intergenic
982617026 4:157651661-157651683 GCTATGATCTTTCTTGCTATAGG - Intergenic
982776566 4:159447703-159447725 GGGAAAAAGTTTCATGATATTGG + Intergenic
983351821 4:166599905-166599927 GGTTATATGTTTCTTGGTCTGGG + Intergenic
985310766 4:188595669-188595691 TGTAAGATGTTGGTTGCTATTGG + Intergenic
986071156 5:4284938-4284960 GGTGAAATGTTTCTCTCTTTAGG + Intergenic
986090039 5:4495196-4495218 AGTAAAATGTTGGTTGCCATTGG - Intergenic
987888813 5:23848624-23848646 GGTAAATTGTGTCTTCCCATAGG + Intergenic
988313396 5:29591772-29591794 GGTAAAATGTTGCTTGACATTGG + Intergenic
989048120 5:37293270-37293292 AGAAAAATCTTTCTTTCTATGGG + Intronic
989986853 5:50711055-50711077 GGTGAATTGTTTGTTGCTACTGG + Intronic
990398861 5:55415591-55415613 GGAAAAATGTATTTTGCTCTAGG + Intronic
990671636 5:58137118-58137140 GGTAAAATGTTAGTTGATTTAGG - Intergenic
992216909 5:74534754-74534776 TGAAAAATGTTTCCTGTTATAGG - Intergenic
993410162 5:87563982-87564004 GGAAAAATATTTCATGCTAATGG - Intergenic
993761842 5:91805101-91805123 GGCATAATTTTTCTTGTTATTGG - Intergenic
994731286 5:103494319-103494341 GGATAAATGTTTCTTGATATTGG - Intergenic
995249580 5:109975935-109975957 GGAAAAATGTTCCTTGATACTGG - Intergenic
995432726 5:112099421-112099443 GGAGAAATGTCTCTTGCTAGCGG - Intergenic
996155718 5:120096809-120096831 GGCAAAAAGTTACTTACTATTGG - Intergenic
997012750 5:129898151-129898173 GGTAAAATGTTTCAGGTGATAGG - Intergenic
998655055 5:144169833-144169855 GATGAAAAGTTACTTGCTATAGG + Exonic
999075115 5:148788331-148788353 GCTGAAATGTTTCTTATTATGGG + Intergenic
1000529251 5:162399020-162399042 GGAAAAATGTTCCTTGACATTGG + Intergenic
1004172170 6:13303783-13303805 GGTAAAACCTTTCTGGCTGTAGG - Intronic
1004757414 6:18627590-18627612 GGAAAAATCCTTCTTGATATTGG + Intergenic
1005797984 6:29387840-29387862 GGTAAAATTTTAATTGGTATAGG - Intronic
1008798032 6:55329711-55329733 GGTAACATTTTTCTTGCTGAGGG - Intronic
1009742423 6:67763751-67763773 GGGAAAATGTTTCTTGACATGGG + Intergenic
1013652008 6:112204955-112204977 GGTGAAATGTTAGTTGATATTGG + Intronic
1013993492 6:116280060-116280082 GGTAAAATTACTGTTGCTATGGG - Intronic
1014209682 6:118695118-118695140 GATAAAATGGTTTATGCTATTGG - Intronic
1014498750 6:122160144-122160166 GGTTATTTGTTTCTTGCTTTTGG + Intergenic
1014669353 6:124281189-124281211 GTTTAGATGTTTCTTGCTGTTGG + Intronic
1014697201 6:124638323-124638345 GGGAAAATGTTTCATGACATAGG + Intronic
1017241297 6:152171936-152171958 AGTACTATGCTTCTTGCTATAGG - Intronic
1017338972 6:153297936-153297958 TTTAAAATATTTCTTGTTATGGG - Intergenic
1017595103 6:156019938-156019960 AATAAAATATTTCTTGCTCTTGG - Intergenic
1020540321 7:9454474-9454496 GGCAACATCTTTCTTGATATTGG - Intergenic
1021664246 7:22959114-22959136 GGTATAATTTGCCTTGCTATTGG + Intronic
1021906184 7:25335857-25335879 GGAAATAGCTTTCTTGCTATTGG + Intergenic
1028030095 7:85900932-85900954 GGTAAAATATCTGTTGCTAAAGG - Intergenic
1028288730 7:89038736-89038758 GGGGAAATGCTTCTTGATATTGG - Intronic
1030377645 7:108771817-108771839 GGTCAAATGTTTATGTCTATGGG + Intergenic
1031490037 7:122375675-122375697 GGGAAAAAGTTTCTTGACATTGG + Intronic
1031561790 7:123247939-123247961 GGTAAAATGTTTCCTTCTCTGGG + Intergenic
1032506622 7:132439926-132439948 GGATAAATGCTTCTGGCTATTGG + Intronic
1033009199 7:137601364-137601386 GGTCAAATATTATTTGCTATGGG - Intronic
1033190009 7:139269224-139269246 AATAAACTGTTTATTGCTATGGG + Intronic
1033851413 7:145500280-145500302 GGAAAAGTATTTCTTTCTATAGG - Intergenic
1035171270 7:157018583-157018605 GGTAATATGTTTTTGGCAATAGG - Intergenic
1036783568 8:11669685-11669707 GGGAAAATGTTTCATGATGTTGG - Intergenic
1040128142 8:43762298-43762320 GATAAACTGTTTTTTCCTATAGG - Intergenic
1041188889 8:55332680-55332702 AGTATAATGTGTCTTGCTATGGG + Intronic
1041245729 8:55886569-55886591 GGTAAAATGTTTCTTGCTATGGG - Intronic
1041754516 8:61299253-61299275 GGTAAAATTTTGCTTCCCATTGG - Intronic
1043669982 8:82872129-82872151 AGAAAATTGTTTCTTGCTGTAGG - Intergenic
1044408830 8:91862370-91862392 GCTAAAATGTTTCTTCAAATGGG + Intergenic
1044911018 8:97058723-97058745 GGTCAAGTGTTTCATGCTACTGG - Intronic
1045434459 8:102147470-102147492 GGTAGAATGTCCCTTGTTATGGG - Intergenic
1046186794 8:110732596-110732618 TGTAAAGTGTTGCTTGCTACTGG - Intergenic
1046977883 8:120302866-120302888 GGAAAAACGTTTCATGCTCTTGG - Intronic
1047664516 8:127076034-127076056 GCTAGAATTTTTCTTGCTTTAGG + Intergenic
1047874851 8:129124442-129124464 GGGGAAATGTTTCTGGGTATTGG - Intergenic
1050005523 9:1125591-1125613 GGTAGAATGTTTCTGGGTATAGG + Intergenic
1052152742 9:25139204-25139226 GGTAAAATGCTTCAGGATATTGG + Intergenic
1052334254 9:27303703-27303725 GTTAAAATGTTTTCTTCTATGGG + Intergenic
1052540129 9:29800626-29800648 GGTAAAATGACGCTGGCTATTGG - Intergenic
1054964721 9:71010143-71010165 GGAAAAATGTTTCATGAAATTGG + Intronic
1055343967 9:75314380-75314402 TGTTAGATGTTTCTTGCCATGGG + Intergenic
1056999721 9:91496603-91496625 GATAAAAAGCTTCTTGCCATCGG + Intergenic
1057382043 9:94577040-94577062 GGTGAAATGTTTCTAGCCAGAGG - Intronic
1058161409 9:101574049-101574071 AGCAAAGTGTTTCTTACTATAGG + Intronic
1059681686 9:116591785-116591807 GGTAATTTGTTTCTTGATTTGGG + Intronic
1059805164 9:117791262-117791284 GGAAAAATGCTTCTTGACATTGG - Intergenic
1060884612 9:127141668-127141690 GTTAAAATGTTTCTTTCTCCAGG - Intronic
1061128950 9:128696421-128696443 AGAGAAATGTTACTTGCTATTGG + Intergenic
1187615359 X:20987884-20987906 GGTAAAATGTGTATTACCATGGG - Intergenic
1187749648 X:22447940-22447962 GTTAAATTGTTTCTTGATCTGGG - Intergenic
1187944222 X:24410822-24410844 AACAAAATGCTTCTTGCTATTGG - Intergenic
1188945356 X:36294035-36294057 AGAAGAATGTTTCTTGCTCTGGG - Intronic
1192778228 X:74267086-74267108 TGTATAATATTTCTTACTATGGG - Intergenic
1193859478 X:86646505-86646527 GGGAAAAAATTTCTTGATATTGG + Intronic
1194129488 X:90063044-90063066 GTTAATCTGTTTCTTGTTATAGG - Intergenic
1198997060 X:142585301-142585323 TTTTAAATGTTACTTGCTATTGG + Intergenic
1199239782 X:145532903-145532925 GGTAAATTGTGTGTTGCTAGGGG - Intergenic
1200296971 X:154929689-154929711 GGTCAAATGTTTCATGTTTTTGG + Exonic
1201346710 Y:12992290-12992312 GGTGAAATGCTTCTTGACATTGG - Intergenic