ID: 1041246232

View in Genome Browser
Species Human (GRCh38)
Location 8:55891017-55891039
Sequence TTCCATTGTATGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 395}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041246232_1041246242 23 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246242 8:55891063-55891085 GAAATGCTGGCTGGGTGCGGTGG No data
1041246232_1041246238 10 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246238 8:55891050-55891072 CCTTTAAAAAAAGGAAATGCTGG No data
1041246232_1041246240 15 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246240 8:55891055-55891077 AAAAAAAGGAAATGCTGGCTGGG 0: 2
1: 4
2: 41
3: 392
4: 3006
1041246232_1041246236 1 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246236 8:55891041-55891063 GTTATTCAGCCTTTAAAAAAAGG No data
1041246232_1041246239 14 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246239 8:55891054-55891076 TAAAAAAAGGAAATGCTGGCTGG No data
1041246232_1041246241 20 Left 1041246232 8:55891017-55891039 CCGTGCCCAGCCATACAATGGAA 0: 1
1: 0
2: 0
3: 53
4: 395
Right 1041246241 8:55891060-55891082 AAGGAAATGCTGGCTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041246232 Original CRISPR TTCCATTGTATGGCTGGGCA CGG (reversed) Intronic
901093290 1:6657933-6657955 TCCCAGAGTCTGGCTGGGCATGG - Intronic
902582753 1:17419062-17419084 TTAAATGGCATGGCTGGGCACGG + Intronic
903045581 1:20562096-20562118 TTGCACTTTTTGGCTGGGCACGG + Intergenic
903054197 1:20623896-20623918 TTAAATTGTTAGGCTGGGCATGG + Intergenic
903079315 1:20796516-20796538 CTTCATAGTATTGCTGGGCACGG + Intergenic
903106722 1:21087330-21087352 TTCTTTCATATGGCTGGGCATGG + Intronic
903248500 1:22034641-22034663 CCCCATTATATGGCTGGGCGCGG + Intergenic
903781588 1:25823443-25823465 TTCCCTTGGGTGGCTGGCCAGGG + Intronic
903863934 1:26383963-26383985 AACCATTTTAGGGCTGGGCAAGG - Intergenic
904227983 1:29040569-29040591 TATTCTTGTATGGCTGGGCATGG - Intronic
905228037 1:36492745-36492767 TGCCGTGGTATGGCTGGGGAGGG + Intergenic
906538662 1:46567828-46567850 TTAAGTTGTTTGGCTGGGCATGG + Intronic
907163839 1:52392416-52392438 TTCCCTTTTCTGGCTGGGCGCGG - Intronic
908168192 1:61479321-61479343 TACCAACTTATGGCTGGGCATGG - Intergenic
908243805 1:62211673-62211695 TTATATTATCTGGCTGGGCACGG + Exonic
908373963 1:63514655-63514677 TTACTTTTTTTGGCTGGGCATGG + Intronic
908735382 1:67270980-67271002 TTACATGGAATGGCTGGGGAGGG - Intergenic
910531522 1:88241670-88241692 CCCCATCGTCTGGCTGGGCATGG + Intergenic
910723927 1:90317638-90317660 TTCCATGGTATGTCTGTGCTAGG + Intergenic
911350044 1:96742994-96743016 TTCCACTTTCTGGCTGGGCGTGG + Intronic
911605198 1:99897103-99897125 TACCATTTTACGGCCGGGCACGG - Intronic
912438433 1:109679178-109679200 TCACATTTTCTGGCTGGGCATGG + Intronic
913271356 1:117096666-117096688 TCTCTTTATATGGCTGGGCACGG - Intronic
913571107 1:120120724-120120746 TACCATTGTCTGGCTTGGAATGG + Intergenic
913984360 1:143551718-143551740 TTCCTTTGTTTGGCTGGGGGAGG + Intergenic
914291917 1:146281702-146281724 TACCATTGTCTGGCTTGGAATGG + Intergenic
914552961 1:148732485-148732507 TACCATTGTCTGGCTTGGAATGG + Intergenic
916790727 1:168122751-168122773 TTACATAGTATGGCTGGGGAAGG - Intronic
917550366 1:176020395-176020417 TTACACTGTAAGGCTGGGCATGG + Intronic
918506999 1:185266352-185266374 TTTAATTCTAAGGCTGGGCACGG - Intronic
918644084 1:186882555-186882577 TTCCAGTGAATGGCTGAGAAGGG + Intronic
919794494 1:201313156-201313178 TTCCATTGTAGATCTGGCCAGGG - Exonic
919874887 1:201857503-201857525 TTTCAGTTTATGGCTGGGCGTGG + Intronic
920003236 1:202813553-202813575 TACCTTTGTATGGCCAGGCACGG + Intergenic
921284187 1:213594153-213594175 TTCCATTTTTAGGCTGGGCATGG - Intergenic
921444082 1:215223913-215223935 TTCCAATGTATGGAAAGGCATGG + Intronic
922280654 1:224120570-224120592 TGTCATTGTAGGGCTGGGCGTGG + Intronic
922420599 1:225458846-225458868 ATCAGTTGTAAGGCTGGGCATGG + Intergenic
922623945 1:227018202-227018224 TTCTGTTCTTTGGCTGGGCATGG - Intronic
923147143 1:231206135-231206157 TTTAATTTTTTGGCTGGGCATGG + Intronic
924530713 1:244891540-244891562 TTCCATTGCAAGGCCGGGCATGG - Intergenic
1063635310 10:7776757-7776779 TTACATGCTTTGGCTGGGCATGG + Intronic
1063651423 10:7941455-7941477 TTCCAGTGAATGGCTGGGGCAGG + Intronic
1064961678 10:20971901-20971923 TTCTATTCTATGGCTGGGCGTGG - Intronic
1065842325 10:29712884-29712906 TGCAATGGTAGGGCTGGGCACGG + Intronic
1066466143 10:35652011-35652033 TGTAATTGTAAGGCTGGGCACGG - Intergenic
1067254395 10:44621530-44621552 TACCATATTTTGGCTGGGCATGG - Intergenic
1067413249 10:46083726-46083748 TTCCATAGCTTGGCTGGGCATGG + Intergenic
1069004738 10:63305076-63305098 TTGCAGTGAGTGGCTGGGCATGG + Intronic
1069050598 10:63788566-63788588 TTTCAGTGTTTGGCTGGGCTCGG + Intergenic
1069211775 10:65770591-65770613 TTACAATTTATGGCTGGGCACGG + Intergenic
1070057345 10:72948164-72948186 TTTCACTCTCTGGCTGGGCAAGG - Intronic
1070831968 10:79423258-79423280 TTTTATTTTCTGGCTGGGCATGG + Intronic
1071142139 10:82521627-82521649 TTCCACAGTCTGGCCGGGCACGG - Intronic
1072231766 10:93419839-93419861 TTTAATTTTAAGGCTGGGCATGG + Intronic
1072711308 10:97717367-97717389 TTCCATTGCATGGTTTGGAAAGG - Exonic
1073294150 10:102428591-102428613 TTCCCTTCCTTGGCTGGGCACGG + Intronic
1073602087 10:104856026-104856048 TTCAAAAGCATGGCTGGGCATGG - Intronic
1074361768 10:112829458-112829480 ATCTATTGATTGGCTGGGCACGG + Intergenic
1074977303 10:118591983-118592005 ATCCTTTCTAGGGCTGGGCATGG - Exonic
1075277179 10:121104698-121104720 CTCTATTGTCTGGCTGGGCTTGG - Intergenic
1075326302 10:121534683-121534705 TGCCATTTTGGGGCTGGGCATGG - Intronic
1075940044 10:126383253-126383275 TTAAATTTTTTGGCTGGGCACGG - Intronic
1076217464 10:128707576-128707598 TTACAATGTTTAGCTGGGCAGGG - Intergenic
1077949793 11:6943983-6944005 GTGCATGGTATGGCTGGGCGTGG + Intronic
1077956568 11:7027004-7027026 ATGCATTGTGTGGATGGGCAAGG - Intronic
1078068638 11:8094231-8094253 CTCCACTGTAGGGCTGGGGAAGG + Intronic
1078824120 11:14910659-14910681 ATACATGGTATGGCTGGGCATGG - Intronic
1078887072 11:15512177-15512199 TTCCATAATATGGCCGGGCATGG + Intergenic
1079400629 11:20103740-20103762 TTCCATTGTTTAACTGGACAAGG - Intronic
1081861830 11:46337584-46337606 ATCCATTTTAAGGCTGGGCGCGG - Intronic
1081982797 11:47279780-47279802 TTCCTTTATTTGGCTGGGCACGG + Intronic
1082052714 11:47785419-47785441 TTTCCTTGTAAGGCTGGGCATGG - Intronic
1083084535 11:60129037-60129059 TTCCACATTTTGGCTGGGCACGG - Intergenic
1083906828 11:65678063-65678085 GCCCATTGGCTGGCTGGGCATGG + Intergenic
1085226689 11:74927659-74927681 TTCCATTCTATGGCTGACTAAGG + Intronic
1085481913 11:76829947-76829969 TCCTAGTGTCTGGCTGGGCAAGG - Intergenic
1085668313 11:78436947-78436969 TTCCATTGTCTGTCTGTGGAGGG - Intronic
1086315952 11:85592658-85592680 TTCTATTGTAAGGCTGGGTGTGG + Intronic
1086836091 11:91624997-91625019 TTCCTTTATATGGCTGAGTAGGG - Intergenic
1086921575 11:92593809-92593831 TTCCATTGCCTGGCTAGGCCAGG + Intronic
1088285879 11:108187158-108187180 TGCTCTTTTATGGCTGGGCATGG + Intronic
1088312577 11:108475757-108475779 ATCCAATTTATGTCTGGGCAGGG - Intronic
1088982133 11:114873410-114873432 TTCCATTATATTGCCGGGCATGG - Intergenic
1091476318 12:776794-776816 TTGCATTGTATGGTTGTCCAAGG + Intronic
1091578302 12:1760682-1760704 TTCCATTGTATGGATATACAGGG + Intronic
1093174727 12:15900239-15900261 TTTTTTGGTATGGCTGGGCACGG + Intronic
1093427661 12:19046914-19046936 TTCCTTTGTATGGCTGCATAGGG - Intergenic
1093589025 12:20877119-20877141 ATCCATTAATTGGCTGGGCATGG - Intronic
1096098362 12:48952906-48952928 AGCCACTGGATGGCTGGGCAGGG + Intronic
1096296933 12:50391930-50391952 TTCCATGGCATGGCATGGCATGG - Intronic
1096318673 12:50591748-50591770 TTTTATCATATGGCTGGGCACGG - Intronic
1097690205 12:62727949-62727971 TTGCATTTTAAGGCTGGGCGTGG - Intronic
1098242880 12:68486445-68486467 TACCATTGAGAGGCTGGGCATGG + Intergenic
1098898645 12:76090141-76090163 TGCCATTGTTAGGCTGGGCGCGG + Intergenic
1098921195 12:76303708-76303730 TTGCATTGTCTGGATGGGCTTGG + Intergenic
1099227308 12:79984571-79984593 TTCCACTGCGTGCCTGGGCAGGG + Intergenic
1100458013 12:94771373-94771395 TTCCATTGTACGGCCAGACAAGG + Intergenic
1101464990 12:104939491-104939513 AGCAATTTTATGGCTGGGCATGG - Intronic
1102117746 12:110416112-110416134 TTGAATTTCATGGCTGGGCATGG - Intergenic
1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG + Intronic
1102374825 12:112413680-112413702 TTCATTTATATGGCCGGGCATGG - Intronic
1102399258 12:112614391-112614413 ATCCTTTGTGGGGCTGGGCATGG + Intronic
1102615845 12:114153478-114153500 TTCTAATGTCTGGGTGGGCAGGG - Intergenic
1102918928 12:116777206-116777228 TCCCATTTTGAGGCTGGGCACGG - Intronic
1103336429 12:120193592-120193614 ATTCATTGTTTGGCTGGGCGTGG - Intronic
1104045716 12:125161127-125161149 TTCCTTTGCAAGGCTGGGCATGG + Intergenic
1104341062 12:127949130-127949152 TTAAATAATATGGCTGGGCACGG + Intergenic
1105765485 13:23554610-23554632 TTGAAATGGATGGCTGGGCATGG + Intergenic
1105994437 13:25656645-25656667 ATACATTTTCTGGCTGGGCATGG + Intronic
1106111466 13:26781393-26781415 TTCTGTTCTATGGCAGGGCAGGG + Intergenic
1106251406 13:27984686-27984708 TCCCATTTTAAGGCTGGGCGCGG + Intronic
1106287191 13:28328387-28328409 TTCCACTGCATGCCTGGGCTGGG + Intronic
1108845000 13:54667255-54667277 ATTCATTTTATAGCTGGGCACGG - Intergenic
1112446679 13:99470800-99470822 TTAAATTTTAGGGCTGGGCATGG + Intergenic
1113305088 13:109068879-109068901 TTACATTGCTGGGCTGGGCACGG - Intronic
1113658410 13:112086013-112086035 TACCAGTCAATGGCTGGGCAGGG + Intergenic
1114573592 14:23693272-23693294 TTCCATTGCACTGCTGGGTAGGG - Intergenic
1114588081 14:23833093-23833115 TTCCATGGTCAGGCTGGGCGTGG - Intergenic
1114625742 14:24128842-24128864 TTAAATTTTTTGGCTGGGCACGG + Intronic
1115243796 14:31274651-31274673 TTAAATAATATGGCTGGGCATGG + Intergenic
1115675429 14:35668190-35668212 TTAAAATGTAAGGCTGGGCATGG + Intronic
1115765082 14:36614938-36614960 ATCAATTGTGGGGCTGGGCATGG + Intergenic
1116828564 14:49695286-49695308 ATACATTTCATGGCTGGGCACGG - Intronic
1117021072 14:51571083-51571105 ATCCACAGCATGGCTGGGCATGG + Intronic
1118214360 14:63794478-63794500 TTCTATAACATGGCTGGGCACGG - Intergenic
1119313065 14:73667169-73667191 TTTAATTTTATGGCTGGGGACGG + Intronic
1119916590 14:78407672-78407694 TTCCCAAGTGTGGCTGGGCATGG - Intronic
1120771801 14:88387188-88387210 TCCCATGGTAGGGATGGGCAGGG + Intronic
1120902576 14:89588620-89588642 TTCCAGTATTTGGTTGGGCATGG - Intronic
1122752883 14:103952056-103952078 TTTCCTTTTATGGCTGGGCATGG - Intronic
1123419385 15:20119016-20119038 TAGCTTGGTATGGCTGGGCATGG + Intergenic
1123528607 15:21125558-21125580 TAGCTTGGTATGGCTGGGCATGG + Intergenic
1124914969 15:33961297-33961319 ATATATTTTATGGCTGGGCATGG - Intronic
1125908850 15:43418205-43418227 ATCCATTTTTTGGCTGGGCATGG + Intronic
1126012994 15:44321121-44321143 TCCCATTGAGTGGCTGGACATGG + Intronic
1126400914 15:48269489-48269511 TTCCATTTTATGCTTGGGTACGG + Intronic
1127149039 15:56054841-56054863 TACCAATGTTTGGCTGGGCACGG - Intergenic
1127923667 15:63516758-63516780 TTTCAAAATATGGCTGGGCATGG + Intronic
1128214122 15:65922636-65922658 TTCCATTGAGTAGCTGGGCTGGG + Intronic
1129277932 15:74459673-74459695 TTCCAATGTCGGGCTGGGCGCGG + Intronic
1129632892 15:77280866-77280888 TTCTATTTCCTGGCTGGGCATGG + Intronic
1130467128 15:84198046-84198068 TTCCATAGCAGGGCAGGGCAGGG + Intergenic
1130497136 15:84475490-84475512 TTCCATAGCAGGGCAGGGCAGGG - Intergenic
1130809309 15:87359684-87359706 TTTTATTGGATGGCTGGGCGCGG - Intergenic
1131110768 15:89763439-89763461 TTAAATTTTATTGCTGGGCATGG + Intronic
1131113591 15:89780325-89780347 TTCCTATGTCTGGCTGGGCGTGG - Intergenic
1131273715 15:90962599-90962621 TTGTTTTGGATGGCTGGGCATGG + Exonic
1131631906 15:94186423-94186445 TTCCATTGTATGGCTACGTCTGG - Intergenic
1132816441 16:1830151-1830173 TTGTATGGTATAGCTGGGCACGG - Intronic
1133118833 16:3594155-3594177 ATCCATTGTTTGGCCGGGCGCGG - Intronic
1133968633 16:10550682-10550704 ATACTTTGTAAGGCTGGGCATGG + Intronic
1134632893 16:15769715-15769737 TTAAATTGTTTTGCTGGGCATGG - Intronic
1135085550 16:19472049-19472071 GTCAAGTTTATGGCTGGGCATGG - Intronic
1136474075 16:30501283-30501305 TTAAAATGTTTGGCTGGGCACGG + Intronic
1137283495 16:46997761-46997783 ATCCAGTCTATGACTGGGCATGG - Intergenic
1137878652 16:52022604-52022626 TTGCATTGTATGTGTGGGCATGG - Intronic
1137972106 16:52995785-52995807 TTTCAAAGTATGGCTGGACATGG + Intergenic
1139324736 16:66143706-66143728 TCCCATTATATGGATGGGGAAGG - Intergenic
1139417241 16:66822956-66822978 TTCAGATTTATGGCTGGGCACGG - Intronic
1140396251 16:74629366-74629388 TTGCTGTGTTTGGCTGGGCATGG + Intronic
1140913403 16:79473708-79473730 TTTTATTGTCTGTCTGGGCATGG - Intergenic
1141349736 16:83283298-83283320 TTCCACAGAATGGCTGGGTACGG + Intronic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1142695584 17:1631075-1631097 TTCCAGTTCCTGGCTGGGCACGG + Intergenic
1142725645 17:1811629-1811651 TTACATTGCTGGGCTGGGCAGGG + Intronic
1143823485 17:9584910-9584932 TTACATTGTGTGGCCAGGCACGG - Intronic
1143883991 17:10052601-10052623 TTGCTTTGCATGGGTGGGCAGGG - Intronic
1143944319 17:10576839-10576861 TTCGATTGAATGTGTGGGCAGGG + Intergenic
1144103753 17:11967395-11967417 TACCATTCTAAGACTGGGCATGG - Intronic
1145053188 17:19680185-19680207 TATCATTTTAAGGCTGGGCATGG + Intronic
1145215793 17:21051349-21051371 TTCTATTTTCTGGCTGGGCATGG - Intergenic
1145939046 17:28732161-28732183 TTGCATTCTGGGGCTGGGCATGG + Intronic
1146224224 17:31051887-31051909 TTTGAGTGTATGGCTAGGCAGGG - Intergenic
1146342529 17:32033266-32033288 TTCCATTTATTGGCTGGGCCTGG - Intronic
1147181600 17:38689942-38689964 TTGCATTTTTTGGCTGGGCGAGG + Intergenic
1147847585 17:43415792-43415814 TTCCTTTAAATAGCTGGGCATGG - Intergenic
1148277107 17:46314611-46314633 TTTCATTTATTGGCTGGGCATGG - Intronic
1148299223 17:46532187-46532209 TTTCATTTATTGGCTGGGCATGG - Intronic
1149342272 17:55699232-55699254 TGCCATTGCATGGATGGGCTTGG - Intergenic
1149751310 17:59148128-59148150 TTTCTTTTTTTGGCTGGGCATGG - Intronic
1150077011 17:62201108-62201130 TTACTTTGTTTGGCCGGGCATGG - Intergenic
1152185216 17:78851875-78851897 TTTTATTTTTTGGCTGGGCACGG + Intergenic
1154947085 18:21172664-21172686 TAACATTTTATGGCGGGGCATGG - Intergenic
1154997193 18:21652200-21652222 TTACATGATGTGGCTGGGCATGG + Intronic
1155013446 18:21806909-21806931 ATACATTATTTGGCTGGGCACGG - Intronic
1156812093 18:41264942-41264964 ATGCAGTGTATGGCTTGGCATGG - Intergenic
1156865902 18:41888401-41888423 AGCCAGTGTCTGGCTGGGCATGG + Intergenic
1157083290 18:44551721-44551743 TTTAATTGTGTGGCTGGGCACGG - Intergenic
1157231238 18:45918013-45918035 TTTCATTGTATGGATGAGGAAGG + Intronic
1158353320 18:56587754-56587776 GTTAATTATATGGCTGGGCATGG - Intergenic
1158472583 18:57750826-57750848 TATCAATGTTTGGCTGGGCACGG + Intronic
1159206935 18:65265201-65265223 ATTCATTGGCTGGCTGGGCACGG - Intergenic
1160161743 18:76478763-76478785 ATCCACTGTGGGGCTGGGCATGG + Intronic
1160718930 19:589273-589295 TTTCCTTGTCTGGCTGGGCTTGG + Intergenic
1161279827 19:3439976-3439998 TTCCAGTGTTTGGCCGGGCGCGG - Intronic
1163083162 19:14958118-14958140 TTGAAGTTTATGGCTGGGCATGG + Intronic
1163348645 19:16761221-16761243 TTTCATTGTATGGATGGACCAGG + Intronic
1163543442 19:17925903-17925925 GTCCACTTTATGGCTGGGCATGG - Intergenic
1163747759 19:19058187-19058209 TTCCATAGCTTGGCTGAGCATGG + Intronic
1164187773 19:22886341-22886363 TTATTTTGTTTGGCTGGGCACGG - Intergenic
1164671323 19:30073714-30073736 TTACACTGTCTGGCTGAGCAGGG + Intergenic
1165465222 19:35970529-35970551 TTCCTTCGTGAGGCTGGGCATGG + Intergenic
1165968661 19:39606135-39606157 TTCCTCTGAAGGGCTGGGCATGG - Intronic
1165979535 19:39708098-39708120 TTCCTCTGAAAGGCTGGGCACGG - Intronic
1166314797 19:41983366-41983388 TTCCATATTAGGGCCGGGCAGGG - Intronic
1166606123 19:44144368-44144390 TTCCATTGTATGGATATGCCAGG + Intronic
1167228739 19:48267993-48268015 GTAAAATGTATGGCTGGGCATGG - Intronic
1168134397 19:54340450-54340472 ATCAATTCTATGGCCGGGCACGG + Intergenic
926169440 2:10542712-10542734 TTACATTTTTTGGCTGGGCATGG - Intergenic
926240114 2:11078989-11079011 ATACATTGCATGGCTGGGCGTGG - Intergenic
926652478 2:15361686-15361708 TTCCAGGAAATGGCTGGGCACGG + Intronic
927171777 2:20376463-20376485 ATCCATTGCATAGCTGAGCATGG + Intergenic
927839262 2:26428506-26428528 TACCATATTATGGCCGGGCACGG + Intronic
928034110 2:27805863-27805885 ATCCATTTTTTGGCCGGGCAAGG - Intronic
928565218 2:32538638-32538660 GTACAGTGTATGGCTGGGCATGG + Intronic
929908723 2:46070351-46070373 TGGCATTTTATGGCTGGGCGCGG + Intronic
930110202 2:47672475-47672497 ATACTTTATATGGCTGGGCACGG + Intergenic
931278317 2:60764091-60764113 TTCAATTGTGAGGCAGGGCATGG - Intronic
931286874 2:60839777-60839799 TTGCATTTCTTGGCTGGGCATGG + Intergenic
936146902 2:109986478-109986500 CTCCAGTGTCGGGCTGGGCAAGG - Intergenic
936197790 2:110385005-110385027 CTCCAGTGTCGGGCTGGGCAAGG + Intergenic
936644416 2:114352022-114352044 TTCTATTTTTGGGCTGGGCATGG - Intergenic
937396144 2:121536591-121536613 TTCCATTGTATGGGTAGACCAGG - Intronic
938076928 2:128344879-128344901 CTCCATTATAAGGCTGGGCACGG - Intergenic
938085606 2:128398622-128398644 ATCAACTGTAGGGCTGGGCACGG - Intergenic
938252179 2:129823998-129824020 TACCACTCTTTGGCTGGGCATGG + Intergenic
938958159 2:136317849-136317871 TACCATTGCCTGGCTGGGCTCGG + Intergenic
939620261 2:144410197-144410219 TTCTTTTTTATGGCTGGGCGCGG - Intronic
942028118 2:171931099-171931121 TGCCATAGTGTGGCTGGGCATGG + Intronic
942177797 2:173351270-173351292 ATACATTTCATGGCTGGGCACGG - Intergenic
942342470 2:174962604-174962626 TATCATGGTATGGCTGGGCACGG + Intronic
942399010 2:175581366-175581388 TTGACTTGTATGGCTGGTCATGG - Intergenic
943667991 2:190630493-190630515 TGCCCTTGTCTGGCAGGGCAGGG - Intergenic
944757802 2:202782053-202782075 TTCAATTTTATGGCCGGACATGG + Intronic
945215468 2:207429429-207429451 ACTCATTGTGTGGCTGGGCATGG + Intergenic
945620155 2:212126171-212126193 TTTAATTTTGTGGCTGGGCATGG + Intronic
946668336 2:222074762-222074784 TTCTATTGTGTAGCTGGGAAGGG - Intergenic
947273246 2:228362886-228362908 TTCCATTGTATGGGTATGCATGG + Intergenic
947835973 2:233175970-233175992 TTCTATTTTCAGGCTGGGCATGG - Intronic
1169377954 20:5082163-5082185 TTTCAGTGAATGGCTGGGCGTGG - Intronic
1170217286 20:13905017-13905039 TTCCATTCTGTGACTGGGGAGGG + Intronic
1170251110 20:14283788-14283810 CTCTTTTGTATGGCTGGGCATGG - Intronic
1171142513 20:22755297-22755319 TTCTGTTCTGTGGCTGGGCAAGG - Intergenic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1173461840 20:43249091-43249113 ATGCATAGTATGGCTGGGCATGG - Intergenic
1173760799 20:45558763-45558785 TTCCCTTGGATGGCAGGACAAGG - Intronic
1173802606 20:45904118-45904140 ATCCAATTTATGGCAGGGCAGGG - Intronic
1174583951 20:51592984-51593006 ATCCATTGACTGGCTGGGCACGG + Intergenic
1174906005 20:54552116-54552138 TAATACTGTATGGCTGGGCAAGG - Intronic
1175696518 20:61106817-61106839 CTCCCTTGAATGGCTGGGCCAGG + Intergenic
1178456116 21:32753166-32753188 TATCATTATACGGCTGGGCACGG + Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1179479317 21:41667609-41667631 TTTCATTGCAAGACTGGGCATGG + Intergenic
1180230276 21:46422955-46422977 TTACTTTATTTGGCTGGGCACGG + Intronic
1181288755 22:21774421-21774443 TTCCTGTGGTTGGCTGGGCACGG + Intronic
1181764318 22:25080239-25080261 TCCCATTGTACAGCTGGGGAAGG - Intronic
1181944008 22:26501169-26501191 TTCCATTACTTGGCTGGGGATGG - Intronic
1182888325 22:33794908-33794930 TCCCATTTTAAGGCCGGGCACGG - Intronic
1182923807 22:34104087-34104109 TTCCACTTTATGGCTAGGCTGGG - Intergenic
1183332200 22:37227703-37227725 TTCAGTTGTATGGCTTGGGAGGG - Intronic
1183506016 22:38209353-38209375 TTCCATGGTTCGGCTGGGCAAGG - Intronic
1183790102 22:40060430-40060452 ATCCATAGGTTGGCTGGGCATGG - Intronic
1184232627 22:43166886-43166908 TTCCAGTGCATGGGAGGGCAGGG - Exonic
1184670825 22:46011601-46011623 TTCTCCTGAATGGCTGGGCAAGG - Intergenic
1184974880 22:48053981-48054003 TCCCATTTTATGGCTGTGGAGGG + Intergenic
1185009579 22:48305665-48305687 CTCCATTTTGTGTCTGGGCACGG - Intergenic
1185026872 22:48419349-48419371 TTCTATTGTAAGGATGGGAAGGG + Intergenic
949198764 3:1345404-1345426 AGTAATTGTATGGCTGGGCATGG - Intronic
949694759 3:6681456-6681478 GTCCAAAGTATGGCTGGGCATGG - Intergenic
950212679 3:11135618-11135640 TACCAATGTAGGGCTGAGCATGG - Intergenic
951935536 3:28018460-28018482 TTCCTTTTTATTGCTGGACATGG - Intergenic
952283069 3:31941982-31942004 ATGCAATGTATGGCAGGGCACGG + Intronic
952954618 3:38549354-38549376 TTCCGATGGCTGGCTGGGCAGGG + Exonic
953554393 3:43931955-43931977 TTGCATTATGGGGCTGGGCACGG + Intergenic
953639193 3:44689562-44689584 TTCCCTTAAAAGGCTGGGCATGG + Intergenic
954477144 3:50757883-50757905 ATTAATTGGATGGCTGGGCACGG + Intronic
954891628 3:53935840-53935862 ATTCATTCTGTGGCTGGGCATGG + Intergenic
955250129 3:57272887-57272909 TTTCATTTTAGGGCCGGGCACGG - Exonic
955311116 3:57887500-57887522 TTTCATGGCTTGGCTGGGCATGG - Intronic
955534098 3:59904808-59904830 TTCCCCTGTGTGGCTGGGCCTGG + Intronic
956155841 3:66295828-66295850 TTCCATTTCTTGTCTGGGCACGG + Intronic
957234056 3:77561811-77561833 TTTCTTTTTCTGGCTGGGCACGG + Intronic
957235063 3:77576767-77576789 TTATATTATATGGATGGGCAAGG - Intronic
957806198 3:85152665-85152687 TTAAAATGTAAGGCTGGGCACGG + Intronic
959706499 3:109343034-109343056 ATCCATTTTATGGCTGGGCGCGG + Intergenic
960097307 3:113700599-113700621 TTCCATTTCTTGGCTGGGCGGGG + Intergenic
961058228 3:123807136-123807158 TTAAATCTTATGGCTGGGCATGG + Intronic
962562767 3:136624388-136624410 TTCCAATAATTGGCTGGGCACGG - Intronic
962588822 3:136868204-136868226 TTACAATGTAAGGCTGGGCATGG - Intronic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
963480597 3:145868404-145868426 TCCCTTTTTTTGGCTGGGCATGG - Intergenic
963498894 3:146100169-146100191 TACTATTGGTTGGCTGGGCATGG - Intronic
964241953 3:154604747-154604769 TTCAAATGTATGGCTGTGAAAGG - Intergenic
965331051 3:167375299-167375321 ATCCATTTTATGGCTGGACGCGG + Intronic
965583895 3:170298161-170298183 TTCAATTTTTTGGCTGGGCATGG - Intronic
965602851 3:170472076-170472098 TTCAATATTCTGGCTGGGCACGG + Intronic
966465026 3:180221972-180221994 TTCCATTGTCTGGATGGACATGG - Intergenic
966789922 3:183657920-183657942 ATTCTTTGTATAGCTGGGCATGG + Intronic
968059919 3:195719986-195720008 TTCGAAGGTGTGGCTGGGCACGG + Intergenic
968561377 4:1284854-1284876 TTCCCTTGTGTGGGTGGGCCAGG - Intergenic
970139887 4:12970304-12970326 TTCCCTTGTATGGTTTAGCAAGG + Intergenic
972539728 4:40028947-40028969 TACTATTTTAAGGCTGGGCATGG + Intergenic
972624731 4:40785649-40785671 TTCCAAAGTGTGGCTGGGCATGG - Intronic
974133320 4:57783664-57783686 TTCCTTTTTATGGCTGAGTATGG + Intergenic
974769392 4:66390902-66390924 TTCCCTTATTTGGCTGGGCGCGG - Intergenic
976599025 4:86920839-86920861 TTCCAATATATGGCCGGGCATGG + Intronic
978438183 4:108708125-108708147 TTTCATAGAATGGCTAGGCACGG - Intergenic
979370902 4:119884960-119884982 CTCTATTTCATGGCTGGGCAGGG - Intergenic
980789459 4:137601317-137601339 TTCCACTGTTAGGCTGGGCACGG + Intergenic
981350455 4:143723438-143723460 AGCCATTGTAGGGCAGGGCACGG + Intergenic
981988807 4:150890837-150890859 TTCTATTGAAAGTCTGGGCAAGG - Intronic
982742039 4:159067519-159067541 TTCATTTGATTGGCTGGGCATGG - Intergenic
983554395 4:169046838-169046860 ATCCCATGTGTGGCTGGGCACGG - Intergenic
984908674 4:184651936-184651958 TTAAAATGTTTGGCTGGGCACGG - Intronic
985362199 4:189187341-189187363 TTACCTTGTTAGGCTGGGCACGG - Intergenic
986248871 5:6037223-6037245 TTTCATTCCATGGCCGGGCACGG - Intergenic
990491060 5:56303463-56303485 TTCCATGGAAAGGGTGGGCAAGG + Intergenic
990784213 5:59401152-59401174 TTCATGTTTATGGCTGGGCATGG + Intronic
990805756 5:59659728-59659750 TGCCCTTTGATGGCTGGGCAAGG - Intronic
991038606 5:62153276-62153298 TTCCATTCTATGAGTGGGCATGG - Intergenic
991721524 5:69498201-69498223 ATTCAGTTTATGGCTGGGCATGG + Intronic
992084457 5:73265502-73265524 TTCAATGGTATCCCTGGGCAAGG + Intergenic
993906319 5:93627728-93627750 ATACATTTTGTGGCTGGGCATGG - Intronic
994510571 5:100698256-100698278 TGGCATTGGATGGCTGGGCTTGG + Intergenic
994624899 5:102206488-102206510 TGCTATTGATTGGCTGGGCATGG - Intergenic
995146685 5:108795024-108795046 TTCCCTTTTTTGGCTGGACATGG + Intronic
995615709 5:113960835-113960857 TTTCATTGTGTGGCTTGCCATGG + Intergenic
996048033 5:118898153-118898175 TTTAATTTTTTGGCTGGGCATGG - Intronic
996418073 5:123231279-123231301 ATTCATTTTCTGGCTGGGCATGG + Intergenic
997147254 5:131449633-131449655 TTCCATAGTATGGATGGGAAAGG - Intronic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
998760630 5:145428247-145428269 TTGAATTGTTTGGCCGGGCACGG - Intergenic
999051099 5:148524592-148524614 TTCCATGCCATGCCTGGGCATGG - Intronic
999849660 5:155524515-155524537 ATGCACTGTCTGGCTGGGCACGG + Intergenic
1000605727 5:163325575-163325597 TTATATTGTAGGGCCGGGCACGG - Intergenic
1002166032 5:177346791-177346813 TTTCTGTGTATGGCTGGGCAAGG - Intronic
1002862815 6:1095162-1095184 TTCTAATGAAAGGCTGGGCAAGG + Intergenic
1003115210 6:3279218-3279240 TTCCTTGATATGGCCGGGCATGG + Intronic
1003700909 6:8463899-8463921 TTCCATGGCATGGCATGGCACGG + Intergenic
1003880214 6:10473678-10473700 ATCTATTTTATGGCTGGGCCTGG - Intergenic
1003944509 6:11061833-11061855 TTCCCTTCTTTGGCTGGGCATGG + Intergenic
1004579226 6:16932482-16932504 ATCCATTTTAAGTCTGGGCATGG + Intergenic
1004886884 6:20059778-20059800 TTCCATTTTATTGCTGAGAATGG - Intergenic
1005028810 6:21490601-21490623 TTCTTTTTTAAGGCTGGGCATGG - Intergenic
1005044018 6:21624907-21624929 TACCATTTTATGGCCGGGCGTGG + Intergenic
1009167648 6:60359813-60359835 TCCCATTTGTTGGCTGGGCACGG + Intergenic
1009622959 6:66099385-66099407 TTCCATTGTATGGATATGTATGG - Intergenic
1009960667 6:70516823-70516845 TACTATTTTATGGCTGGGCACGG - Intronic
1009962904 6:70545320-70545342 TACTATTTTCTGGCTGGGCACGG + Intronic
1010456442 6:76061672-76061694 TTCCATTTTAGGACTTGGCAAGG + Intronic
1013100439 6:106981850-106981872 TACCATTGTGAGGCTGGGCGCGG - Intergenic
1013759341 6:113498640-113498662 TACCATGGTATGGCATGGCATGG + Intergenic
1014172200 6:118291081-118291103 GTCAATTTTCTGGCTGGGCATGG - Intronic
1014269171 6:119316454-119316476 TACCTTTTTTTGGCTGGGCATGG - Intronic
1014412199 6:121139134-121139156 TAATATGGTATGGCTGGGCACGG - Intronic
1015752300 6:136572545-136572567 TTTCAGTTTAGGGCTGGGCATGG - Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1020107337 7:5428185-5428207 CTCCACTGTTTGGCTGGGAAAGG + Intergenic
1021596003 7:22317528-22317550 TTGCATTTTTTGGCTGGGCATGG - Intronic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022266085 7:28756260-28756282 GTACATTGAGTGGCTGGGCACGG + Intronic
1022375950 7:29811179-29811201 ATCTATCTTATGGCTGGGCAAGG - Intronic
1023957555 7:44899085-44899107 TTTCTGTATATGGCTGGGCATGG - Intergenic
1024200734 7:47103439-47103461 TACCTATGTTTGGCTGGGCACGG - Intergenic
1024259956 7:47566747-47566769 TTCCATCTCATGGCCGGGCACGG + Intronic
1024391799 7:48822056-48822078 TTTCATCATCTGGCTGGGCACGG - Intergenic
1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG + Intergenic
1026170722 7:67951683-67951705 TAAAATTTTATGGCTGGGCACGG - Intergenic
1027265040 7:76490035-76490057 TACCACTGGTTGGCTGGGCACGG + Intronic
1027316412 7:76988138-76988160 TACCACTGGTTGGCTGGGCACGG + Intergenic
1027633940 7:80645341-80645363 TCACATACTATGGCTGGGCATGG + Intronic
1027893404 7:84008199-84008221 TTCCATTTTATGGCAGGGCGCGG + Intronic
1028615037 7:92756343-92756365 CTCAATTTTGTGGCTGGGCATGG + Intronic
1028993173 7:97072388-97072410 TTCCATCTTGAGGCTGGGCATGG + Intergenic
1028993553 7:97075876-97075898 TTCCATTATCAGGCTGGGTAGGG + Intergenic
1029098148 7:98105706-98105728 GTCCATGGCTTGGCTGGGCACGG - Intergenic
1029406858 7:100380503-100380525 TTCCATTAAAGGGCTGGGCGTGG + Intronic
1029411475 7:100414734-100414756 TACCATTATCAGGCTGGGCACGG + Intronic
1031168619 7:118262457-118262479 AACCATTTTGTGGCTGGGCATGG - Intergenic
1031730743 7:125298033-125298055 TTTAAATGTGTGGCTGGGCACGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032290592 7:130586750-130586772 TTCCATAAGTTGGCTGGGCACGG - Intronic
1032554554 7:132818025-132818047 TTCCATAGTTTGGCTGGGGTGGG - Intronic
1032696855 7:134344605-134344627 TTGCATTTTCTGCCTGGGCAGGG + Intergenic
1034390411 7:150782905-150782927 TTCTATTTTCTGGCTGGGCACGG + Intergenic
1034646809 7:152655060-152655082 TTCCATAATTTGGCTGGACAAGG - Intronic
1035171077 7:157017845-157017867 TTCCATTGAAAGGCTGGAGAAGG + Intergenic
1036430911 8:8689581-8689603 TTCCATTCTCTGGCTGGGCTGGG - Intergenic
1038909560 8:31947651-31947673 TACCACTTAATGGCTGGGCATGG + Intronic
1039024401 8:33242043-33242065 TAGCAGTGTCTGGCTGGGCAGGG + Intergenic
1039067334 8:33620261-33620283 TACCTTTTTCTGGCTGGGCACGG + Intergenic
1039548594 8:38427568-38427590 TCCCATAATTTGGCTGGGCATGG - Intronic
1040419608 8:47226516-47226538 TTCTACTTTTTGGCTGGGCATGG + Intergenic
1041222312 8:55664044-55664066 TACCATTTGAAGGCTGGGCATGG - Intergenic
1041246232 8:55891017-55891039 TTCCATTGTATGGCTGGGCACGG - Intronic
1041776342 8:61527438-61527460 TTCCCTTGTTTGGCTGGGGCTGG - Intronic
1042550287 8:69988419-69988441 ATCATTTTTATGGCTGGGCACGG - Intergenic
1042845709 8:73167847-73167869 TTCCATATTCTGGCTGTGCACGG + Intergenic
1045285021 8:100783150-100783172 TTCCATTGTGAGGCCAGGCATGG + Intergenic
1045983708 8:108222333-108222355 TTTCAAAGTCTGGCTGGGCATGG - Intronic
1046920278 8:119720602-119720624 GCCCATTGTATGGTTGAGCATGG - Intergenic
1047820539 8:128514969-128514991 TTCCCTTGTGTTTCTGGGCAGGG - Intergenic
1048600109 8:135910778-135910800 ATCTATTCTAAGGCTGGGCAAGG + Intergenic
1049906786 9:225221-225243 TTTGATTGTGTGGCTGGGGAGGG + Intronic
1049983994 9:931221-931243 TTCCATTATATGGAGGGGCTTGG + Intronic
1050013079 9:1205187-1205209 TAACATTTTCTGGCTGGGCATGG - Intergenic
1050538453 9:6649849-6649871 TTCCATGATCTGGCTGGGCGTGG - Intergenic
1050594133 9:7188941-7188963 CTCCATTGTGTGAGTGGGCAGGG + Intergenic
1051630836 9:19139517-19139539 TTGCCCTTTATGGCTGGGCACGG + Intronic
1052708271 9:32019721-32019743 TTGCTTTTTCTGGCTGGGCATGG - Intergenic
1053352288 9:37421650-37421672 TTTAAATGTATGGCTGGGCGCGG - Intergenic
1055046035 9:71925228-71925250 TTCCTTTTCTTGGCTGGGCACGG + Intronic
1055882675 9:81020441-81020463 TTTCATTGCATAGGTGGGCAAGG - Intergenic
1056174539 9:84021191-84021213 TTTAATTGCCTGGCTGGGCACGG - Intergenic
1056637187 9:88340983-88341005 TTGTATTTGATGGCTGGGCACGG + Intergenic
1056801292 9:89693927-89693949 TACCATTGCATGACAGGGCATGG + Intergenic
1056886366 9:90447794-90447816 TTCCAGTGTATGGCTTATCATGG - Intergenic
1057356601 9:94337009-94337031 TACATTTTTATGGCTGGGCACGG - Intergenic
1057603403 9:96479799-96479821 TACCATGTTTTGGCTGGGCACGG - Intronic
1057855274 9:98596579-98596601 TTCCATGGCAGGGCTGGGCTGGG - Intronic
1060128102 9:121069802-121069824 TCCCTTTTTCTGGCTGGGCAAGG - Intergenic
1060132596 9:121119225-121119247 TTTCATTGTATTGCAGAGCAAGG + Intronic
1061236831 9:129348135-129348157 TTACAATTTTTGGCTGGGCACGG + Intergenic
1185773558 X:2784290-2784312 TTAAAATGTGTGGCTGGGCATGG + Intronic
1185882897 X:3757101-3757123 TGCAATTATAGGGCTGGGCACGG - Intergenic
1185921230 X:4095589-4095611 ATACGTTGTATGGCCGGGCACGG + Intergenic
1186417345 X:9395196-9395218 TTACATTTTCTGGCTGGGCATGG - Intergenic
1186845826 X:13529988-13530010 ATCCACATTATGGCTGGGCATGG - Intergenic
1187039046 X:15573846-15573868 TACCATTGATTGGCTGGACACGG - Intronic
1187486450 X:19708584-19708606 TTCCATTGTATGGGAAGCCATGG - Intronic
1187516578 X:19976679-19976701 TTCTGTTTTCTGGCTGGGCATGG - Intergenic
1187665723 X:21607511-21607533 TTCCATGGTCAGGCCGGGCATGG + Intronic
1187727962 X:22223452-22223474 TTAGAGTGAATGGCTGGGCATGG + Intronic
1187809033 X:23155146-23155168 TTACATTTTTTGGCTGGGCGCGG - Intergenic
1187897342 X:23994965-23994987 TTACATTTTCAGGCTGGGCAAGG - Intronic
1188077397 X:25795127-25795149 TTTCATTGTATGTTTTGGCAAGG + Intergenic
1189443830 X:41062119-41062141 CTCCATTGTGGGGCTGGGCACGG + Intergenic
1190501679 X:51085304-51085326 TTAAATTTTGTGGCTGGGCACGG + Intergenic
1192578955 X:72264942-72264964 TTGAATTTTTTGGCTGGGCATGG - Intronic
1192877112 X:75242399-75242421 TTGCACTGTATAGCTGGGAAAGG - Intergenic
1193382889 X:80836735-80836757 TTCAATTTTCTGGCTGGGCGTGG - Intergenic
1193567001 X:83088892-83088914 TACTATTTTTTGGCTGGGCACGG + Intergenic
1196681023 X:118469666-118469688 AACCTTTGTGTGGCTGGGCATGG - Intergenic
1199006467 X:142703936-142703958 ATGCATTTTATGGCTGGGCATGG - Intergenic
1200535706 Y:4394988-4395010 TGCCATTCATTGGCTGGGCATGG + Intergenic
1201273347 Y:12276940-12276962 ATCCAATGTTTGGCTGGGCATGG - Intergenic
1201861043 Y:18597467-18597489 TACCATTGCATTGCTGGGTAGGG + Intergenic
1201872280 Y:18722913-18722935 TACCATTGCATTGCTGGGTAGGG - Intergenic