ID: 1041246513

View in Genome Browser
Species Human (GRCh38)
Location 8:55893889-55893911
Sequence TCACTTCAGCCCAGGATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2411
Summary {0: 1, 1: 1, 2: 39, 3: 500, 4: 1870}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041246513_1041246519 8 Left 1041246513 8:55893889-55893911 CCTGAGATCCTGGGCTGAAGTGA 0: 1
1: 1
2: 39
3: 500
4: 1870
Right 1041246519 8:55893920-55893942 CCTCAGCTTCTCGAGTAGCTGGG 0: 194
1: 8194
2: 131520
3: 307860
4: 213373
1041246513_1041246517 7 Left 1041246513 8:55893889-55893911 CCTGAGATCCTGGGCTGAAGTGA 0: 1
1: 1
2: 39
3: 500
4: 1870
Right 1041246517 8:55893919-55893941 GCCTCAGCTTCTCGAGTAGCTGG 0: 164
1: 7152
2: 121289
3: 279502
4: 212348
1041246513_1041246520 16 Left 1041246513 8:55893889-55893911 CCTGAGATCCTGGGCTGAAGTGA 0: 1
1: 1
2: 39
3: 500
4: 1870
Right 1041246520 8:55893928-55893950 TCTCGAGTAGCTGGGACTAGAGG 0: 20
1: 2400
2: 70037
3: 206015
4: 281396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041246513 Original CRISPR TCACTTCAGCCCAGGATCTC AGG (reversed) Intronic
Too many off-targets to display for this crispr