ID: 1041247137

View in Genome Browser
Species Human (GRCh38)
Location 8:55899327-55899349
Sequence GTTTAGGGGTCCGGCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041247137_1041247142 8 Left 1041247137 8:55899327-55899349 CCAAGTCAGCCGGACCCCTAAAC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1041247142 8:55899358-55899380 TTGTTTTATTTAACTTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041247137 Original CRISPR GTTTAGGGGTCCGGCTGACT TGG (reversed) Intronic
901025765 1:6277999-6278021 GTTTAGAGCTCTGGCTGACCCGG + Intronic
904504448 1:30939349-30939371 GTTCAGGGGTCAGCCGGACTTGG + Intronic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
906784344 1:48601157-48601179 GTTTGGGGGTCTGGTAGACTTGG + Intronic
906921519 1:50069783-50069805 GTTCTGGGGTCAGGCTGTCTAGG - Intronic
911653771 1:100419304-100419326 GATTCTGGGTCTGGCTGACTGGG + Intronic
912159655 1:106966323-106966345 ATTTAGGATTCCGGCCGACTTGG - Intergenic
914329117 1:146649658-146649680 GTTTTGGGGTCGGCCTGCCTTGG - Intergenic
917217827 1:172696421-172696443 TTGTAGGGGTCCGGTTGTCTGGG - Intergenic
1064988708 10:21237011-21237033 GCTTAGGTGTCAGGCTGCCTGGG - Intergenic
1069681849 10:70291223-70291245 GATCAAGGTTCCGGCTGACTTGG + Intergenic
1070428987 10:76317133-76317155 CTTTAGGAGTCAGGCTGATTTGG + Intronic
1070679107 10:78436329-78436351 GTTTTGGAGTCTGGCAGACTAGG + Intergenic
1076529317 10:131134013-131134035 GTTTAGGGGTCAGGCAGCCCTGG - Intronic
1078358012 11:10647223-10647245 GCTTTGGGGTCAGGCTGCCTGGG + Intronic
1081662191 11:44894908-44894930 GGTTTGGGGTCCAGCTGACTTGG + Intronic
1081847496 11:46251486-46251508 CTTCAGGGGTCCTGCTGAGTAGG - Intergenic
1087870622 11:103288911-103288933 GTTTAGGGGTCATGCAGCCTCGG + Intronic
1089746482 11:120620998-120621020 GTTTTGGAGTCAGGCTGACTTGG - Intronic
1090877249 11:130801709-130801731 GTAGAGGGGTCTGGCTGTCTGGG + Intergenic
1093909550 12:24730500-24730522 CTTTAGGGGTGGGGCTGAGTTGG - Intergenic
1093980730 12:25472426-25472448 GTTTAGGGCAGCTGCTGACTGGG + Intronic
1095808814 12:46349986-46350008 GTCTAGGAGTAAGGCTGACTAGG + Intergenic
1101398384 12:104367641-104367663 TTTTAGGTGTCAGCCTGACTGGG + Intergenic
1107265950 13:38554645-38554667 TTTCAGGGGTCCTGGTGACTGGG - Intergenic
1118718230 14:68575442-68575464 GGTTTGGGGTCTGGCTGATTTGG + Intronic
1122197128 14:100096730-100096752 GTTTAGAGGTCAGGCAGACCTGG + Intronic
1123417098 15:20102216-20102238 GCTTAGGGGGCTGGCTGGCTTGG + Intergenic
1123447818 15:20342893-20342915 GCTTAGGTGGCTGGCTGACTTGG - Intergenic
1123489086 15:20765466-20765488 GTTTAGGGGTCTGGTTGTCTGGG - Intergenic
1123526437 15:21109322-21109344 GCTTAGGGGGCTGGCTGGCTTGG + Intergenic
1123545585 15:21334553-21334575 GTTTAGGGGTCTGGTTGTCTGGG - Intergenic
1125606910 15:40944656-40944678 GTGGAGAGGTCCGGCTGACCAGG - Intergenic
1126110507 15:45172209-45172231 GCTTAGGGGTTTGGCTGACTTGG + Exonic
1128340046 15:66815925-66815947 GTTTAGGGGTAGGGATGAATAGG + Intergenic
1202953928 15_KI270727v1_random:61823-61845 GTTTAGGGGTCTGGTTGTCTGGG - Intergenic
1134045804 16:11099975-11099997 GTTTGGAGGCACGGCTGACTGGG + Intronic
1134058726 16:11186211-11186233 GTTTATGTGTCAGCCTGACTGGG + Intergenic
1134819386 16:17233903-17233925 GCTTGGGGGTGCGGCAGACTTGG + Intronic
1142010332 16:87710742-87710764 CTTTCTGGGTCCGGCTGACCTGG + Intronic
1142471403 17:165115-165137 GTTTGGGGGCCTGGCTGGCTTGG + Intronic
1143886821 17:10071136-10071158 TTTTTGGGGTCCTGCTGGCTGGG - Intronic
1146453097 17:32990445-32990467 GCTTTGGGGTCAGGCTGACCAGG - Intronic
1151367802 17:73628627-73628649 GTTTAGGGGTGTGGCTCTCTGGG - Intronic
1152160474 17:78665395-78665417 GTTTGGGGATCCGGCTGACCTGG + Intergenic
1158642516 18:59215753-59215775 GTTTAGGAGTCAGGCTGGCCTGG - Intergenic
1167957719 19:53080397-53080419 GTTTAAGAGTACTGCTGACTGGG - Intronic
925530509 2:4855626-4855648 GCTTAGGGCTCCCACTGACTCGG + Intergenic
935550858 2:104452208-104452230 GCTTTGGGGTCAGGCTGACTTGG - Intergenic
939177709 2:138768920-138768942 GTTTTGATGTCAGGCTGACTTGG - Intronic
944407349 2:199399999-199400021 GTTTTGGAGTCAGGCAGACTTGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945455558 2:210047992-210048014 GATTAGAGGTCTGGATGACTGGG - Intronic
946696066 2:222360415-222360437 GTTTAGTGGTTCTGCTGACCTGG - Intergenic
948287420 2:236796924-236796946 GGTCAGGGGCCTGGCTGACTAGG - Intergenic
948503107 2:238409068-238409090 ATTTAGGGGTCTGGCTGCGTTGG + Intergenic
950264722 3:11565172-11565194 GCTTTGGTGTCCGGCTGACCCGG - Intronic
952163361 3:30718858-30718880 TTTTAGGGATGGGGCTGACTTGG - Intergenic
954624186 3:52013553-52013575 GTATGTGGGTCTGGCTGACTGGG + Intergenic
955955315 3:64282961-64282983 GTTTAGGAGCCAGACTGACTGGG - Intronic
960674852 3:120184061-120184083 GTTTAGGGGTAGGCCAGACTAGG - Intronic
964482917 3:157160119-157160141 GTTTCGGGTTCCGGCTGCGTTGG - Exonic
966605682 3:181819606-181819628 GTTTATGAGTCGGGCAGACTTGG + Intergenic
966941331 3:184749799-184749821 GCTCTGGGGTCCGGCAGACTTGG - Intergenic
972939343 4:44178049-44178071 GGTTTGGGGTCCTACTGACTTGG + Intronic
982205043 4:152991416-152991438 GTTTGGGGTTCCAACTGACTTGG - Intergenic
982766460 4:159354583-159354605 GTTTAGGAGTCAGGCGGACTGGG + Intronic
988459924 5:31425776-31425798 GCTTAGGAGTCAGGCTGCCTGGG + Intronic
990782589 5:59382751-59382773 GTTTTGGGGTCAGACTGACCTGG + Intronic
991489181 5:67166251-67166273 GTGTTGGCGGCCGGCTGACTCGG - Exonic
1001778596 5:174348061-174348083 GTTTAGGAGTCAGTCAGACTTGG + Intergenic
1007557401 6:42778314-42778336 GTTTTGGGGTCAGCCAGACTTGG + Intronic
1014442117 6:121486190-121486212 GTGTAGGGCTGAGGCTGACTTGG + Intergenic
1018372502 6:163181180-163181202 GTTTCAGGGTCAGTCTGACTCGG - Intronic
1028838270 7:95397758-95397780 GTTTGGGAGTCAGGCTGCCTGGG + Intergenic
1030504089 7:110398017-110398039 GTTTTAAGGTCAGGCTGACTGGG - Intergenic
1033548147 7:142421082-142421104 GTTTAGGGGCCCTGCAGACCAGG + Intergenic
1034330911 7:150281543-150281565 CTCTAGGGCTCCTGCTGACTTGG - Intronic
1034667132 7:152828310-152828332 CTCTAGGGCTCCTGCTGACTTGG + Intronic
1034882209 7:154771328-154771350 GATTAGGGTTCCGGCTGATTTGG + Intronic
1039858040 8:41433443-41433465 GTTTAGGTGTCCACTTGACTGGG + Intergenic
1041247137 8:55899327-55899349 GTTTAGGGGTCCGGCTGACTTGG - Intronic
1049012463 8:139896589-139896611 GTTCAGGGGTCAGCCTGGCTGGG - Intronic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1055401035 9:75924446-75924468 GTTTTGGAGTCAGGCTGACATGG + Intronic
1058360830 9:104144176-104144198 GGATAGGGGTCAGGCTGAGTTGG - Intergenic
1062031596 9:134364455-134364477 GTGTGGGGGTCCGGCTGTCATGG + Intronic
1062377700 9:136270612-136270634 GTTTAGGCCTCCGGATGACTGGG + Intergenic
1191992401 X:67052339-67052361 ATTTAGGAGTCAGACTGACTGGG + Intergenic
1195039207 X:100998789-100998811 GTTTTGGAGTCAGGCTGACCTGG - Intergenic