ID: 1041248995

View in Genome Browser
Species Human (GRCh38)
Location 8:55916740-55916762
Sequence TGCCATTGCAGTATTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041248995 Original CRISPR TGCCATTGCAGTATTGGGCA TGG (reversed) Intronic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
905807498 1:40887407-40887429 AGCCATTGCAGGTTTGGGCAGGG + Intergenic
906708319 1:47910960-47910982 GGCCATTCCAGCCTTGGGCAAGG - Intronic
909951339 1:81723485-81723507 TTCCTTTGAATTATTGGGCAGGG + Intronic
918037799 1:180892851-180892873 TGCTATTGCAGTACTGGTGAGGG - Intergenic
918128577 1:181605399-181605421 TGCCAGTGCTGCCTTGGGCATGG - Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
1065137427 10:22685811-22685833 TGCCATTGCTGTGAGGGGCATGG - Intronic
1066626561 10:37412935-37412957 TGCTAATGAAGTTTTGGGCATGG + Intergenic
1072633819 10:97164757-97164779 TGCCACGGCAGTCCTGGGCAGGG - Intronic
1075813250 10:125244313-125244335 TGCCATTTCAGACTTGGGAATGG - Intergenic
1076121996 10:127943872-127943894 TGGGGTGGCAGTATTGGGCATGG + Intronic
1077375092 11:2202058-2202080 AGACATTGCATTTTTGGGCAGGG - Intergenic
1081591760 11:44427960-44427982 TGCCATCGCCATATTGGGGAAGG - Intergenic
1081878827 11:46430308-46430330 TGCCATTGTGGTTTTGTGCATGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1087183485 11:95161497-95161519 TGCCCCTCCAGTATTTGGCAGGG - Intergenic
1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG + Intergenic
1095772034 12:45970440-45970462 TGTCATGGCAGGATTGGGCTTGG - Intronic
1098202251 12:68068526-68068548 TCCCATTGCAGTATTGGAGCAGG - Intergenic
1099633952 12:85188648-85188670 TGGCATTGCTGTAGTGGGAAGGG - Intronic
1100014308 12:89990324-89990346 TGTGAATGCAGTACTGGGCATGG + Intergenic
1100237522 12:92675329-92675351 TGCAATTGAAGTCTTGGCCAGGG - Intergenic
1104794775 12:131509791-131509813 TGGCATTGGAGTAGAGGGCACGG + Intergenic
1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG + Intergenic
1113217764 13:108062012-108062034 TGTCATTTCAGGATTGGTCATGG - Intergenic
1114730984 14:24992334-24992356 TGCCTTTGCAGCATTGGTCATGG - Intronic
1116761589 14:49021963-49021985 TGCCATTGCTGTCTTGGGGTCGG - Intergenic
1121981478 14:98458089-98458111 TGCCATTGAACTATTGTGCCTGG - Intergenic
1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG + Intergenic
1127378015 15:58402740-58402762 AGTCATGGCAGTAATGGGCACGG - Intronic
1127535428 15:59885752-59885774 TGGTCTTGCAGTATGGGGCAGGG + Intergenic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1129988462 15:79940113-79940135 TGCCATTGCACCATCTGGCATGG - Intergenic
1130842068 15:87710060-87710082 TGACCTTGCAGTCTTGGGTAAGG + Intergenic
1133466941 16:6036406-6036428 TGCCATTGCTTTTTTGGGGAGGG + Intronic
1135220149 16:20607389-20607411 TGCCTTTGAAGTATTGAGCCTGG - Intergenic
1138043975 16:53702441-53702463 AGGCATTGCAGCATTGTGCAGGG - Intronic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1143848440 17:9791131-9791153 TGCCATCTCAGGACTGGGCAAGG - Exonic
1146019045 17:29259737-29259759 TGCTCTTGCATTATTGGGAATGG - Exonic
1148006591 17:44436117-44436139 TGCCTTTGTAGAATTGGGTACGG - Intronic
1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG + Exonic
1153582539 18:6589057-6589079 GGCCATTGCAGTACTAGGCCTGG - Intronic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
927336055 2:21925974-21925996 TGCCTTTCCAGTATATGGCATGG + Intergenic
931402980 2:61948974-61948996 AGCCATTGAAGTGCTGGGCACGG + Intronic
936286227 2:111183410-111183432 TGCCATTCCTGTAAAGGGCACGG + Intergenic
936941547 2:117889431-117889453 TACCACTGCAGTATTGAGCAGGG - Intergenic
937857697 2:126684479-126684501 TGCCAGTGTGGTAGTGGGCATGG - Intronic
941855773 2:170228912-170228934 TGAAATTGAAGTATTTGGCAGGG - Intronic
946367898 2:219261544-219261566 TGCTAGTGAAGAATTGGGCAGGG + Intronic
947132222 2:226940472-226940494 TGCCATTTAAGTCTTGGGAAGGG + Intronic
1168731339 20:84173-84195 TGCCATTGGAGTATTGGGGTAGG - Intergenic
1177885403 21:26740529-26740551 GGCCATTCCAGTATTGCACAAGG + Intergenic
1179008103 21:37531882-37531904 TGCCCATGCAGTACTGGGCGGGG - Intergenic
1183598997 22:38829241-38829263 TGCAATTGCTGTCTAGGGCAGGG + Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
951862257 3:27266255-27266277 AGTCTTTGCAGTATTGGGCTAGG - Intronic
956445154 3:69318847-69318869 TTCCATGGCAATATTTGGCAAGG + Intronic
961154315 3:124666017-124666039 TTCCTTTGCAGTATGGGCCAAGG - Intronic
961642318 3:128372350-128372372 TGCCATGGCAGTCCAGGGCATGG - Intronic
964247520 3:154670347-154670369 TGCCATTGTAGTAGTGGGATAGG - Intergenic
967832453 3:193932003-193932025 TGGCATGGCAGTTTTGGGGAAGG - Intergenic
968258928 3:197303185-197303207 TACCATTTCAGTATTCAGCAGGG - Intergenic
970365159 4:15350662-15350684 TGCCATTGCTATATTGGACTGGG + Intronic
971666999 4:29500270-29500292 TGAGATTGCAATGTTGGGCAAGG - Intergenic
978921447 4:114188015-114188037 GGCCTTTGCAGAATTAGGCATGG - Intergenic
980629925 4:135417979-135418001 TGGCATTACAGTATTGCCCAGGG + Intergenic
983651812 4:170043237-170043259 TGCAAGTGCAGAGTTGGGCAAGG - Intergenic
986932642 5:12845902-12845924 TGCCATAGCAGTTTGGGTCACGG - Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
993314671 5:86386811-86386833 TGACATTGAAACATTGGGCACGG - Intergenic
993704946 5:91159106-91159128 TGCCATTGCTCTAAGGGGCAAGG + Intronic
997346040 5:133192894-133192916 TGCTATGACAGTATTAGGCAGGG - Intergenic
998970575 5:147586966-147586988 TTCCATTTCAGAATGGGGCAGGG - Intronic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG + Intergenic
1001206258 5:169766006-169766028 TATCATTGCAGCATTGGGCTAGG + Intronic
1002837976 6:881363-881385 TGCCACTCCAGAATTGAGCAGGG - Intergenic
1004071029 6:12297877-12297899 TGCAATTGCAGTATTGCAAATGG + Intergenic
1005081061 6:21956930-21956952 TGTCATCCCAGTATTGTGCAGGG + Intergenic
1009400587 6:63250309-63250331 TGCTATTGCAGTATTTGGCTTGG + Intergenic
1011261635 6:85476277-85476299 TCCCATTTCAGTTTTGGACATGG - Intronic
1014599620 6:123394135-123394157 TGCCACTGCAGTTTAGGGAAGGG - Intronic
1017148016 6:151252148-151252170 GGCTTTTGGAGTATTGGGCAAGG + Intronic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022860035 7:34358133-34358155 AGCTATTGCAGTCGTGGGCATGG - Intergenic
1028950451 7:96629850-96629872 AACCACTGCATTATTGGGCATGG - Intronic
1030758752 7:113324137-113324159 TTCCATTGCAGTATTAGTTAAGG + Intergenic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1038563318 8:28599065-28599087 TTCCTTTGAATTATTGGGCAGGG - Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1043366809 8:79542681-79542703 AGCCATAGCAGGATAGGGCATGG + Intergenic
1043391490 8:79796482-79796504 TGCCATTATTGTATTGGGCTTGG + Intergenic
1053093382 9:35301159-35301181 AGCCATGGCAGTATTGGGGAAGG + Intronic
1053530856 9:38879413-38879435 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054203079 9:62103846-62103868 TGCCAGTGCAAAATTGGACATGG + Intergenic
1054635284 9:67484519-67484541 TGCCAGTGCAAAATTGGACATGG - Intergenic
1055774398 9:79752204-79752226 TCCCATTGCTGTATAGAGCAGGG + Intergenic
1056062256 9:82895909-82895931 GGCCAGTGCAGTTTTGAGCATGG - Intergenic
1061757549 9:132826015-132826037 TGCCCTTGCCTTTTTGGGCAGGG + Intronic
1187844792 X:23524338-23524360 TGCCATTGCTGTTGTGGGGATGG - Intergenic
1189313234 X:40034720-40034742 TGCCATTGCAGCAATGGGCTGGG + Intergenic
1196254480 X:113500163-113500185 TGCCATTGCAGAATATGGCAAGG - Intergenic