ID: 1041249228

View in Genome Browser
Species Human (GRCh38)
Location 8:55918639-55918661
Sequence CCAGGTGTTCGGGGTTGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041249215_1041249228 29 Left 1041249215 8:55918587-55918609 CCATCACCACACATAAGTGATGT No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249223_1041249228 -8 Left 1041249223 8:55918624-55918646 CCAGATTGAGTGGTGCCAGGTGT No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249219_1041249228 -3 Left 1041249219 8:55918619-55918641 CCCTCCCAGATTGAGTGGTGCCA No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249216_1041249228 23 Left 1041249216 8:55918593-55918615 CCACACATAAGTGATGTTGACCA No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249217_1041249228 3 Left 1041249217 8:55918613-55918635 CCAGAGCCCTCCCAGATTGAGTG No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249222_1041249228 -7 Left 1041249222 8:55918623-55918645 CCCAGATTGAGTGGTGCCAGGTG No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data
1041249220_1041249228 -4 Left 1041249220 8:55918620-55918642 CCTCCCAGATTGAGTGGTGCCAG No data
Right 1041249228 8:55918639-55918661 CCAGGTGTTCGGGGTTGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041249228 Original CRISPR CCAGGTGTTCGGGGTTGTCT CGG Intronic