ID: 1041250540

View in Genome Browser
Species Human (GRCh38)
Location 8:55930113-55930135
Sequence TTTTTCCACAGAGCGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 12, 3: 124, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041250540_1041250544 2 Left 1041250540 8:55930113-55930135 CCTGACCCCGCTCTGTGGAAAAA 0: 1
1: 0
2: 12
3: 124
4: 449
Right 1041250544 8:55930138-55930160 GCCTTCCATGAAACCAGTCACGG No data
1041250540_1041250551 20 Left 1041250540 8:55930113-55930135 CCTGACCCCGCTCTGTGGAAAAA 0: 1
1: 0
2: 12
3: 124
4: 449
Right 1041250551 8:55930156-55930178 CACGGATGCTAAAAAGGTTGGGG No data
1041250540_1041250550 19 Left 1041250540 8:55930113-55930135 CCTGACCCCGCTCTGTGGAAAAA 0: 1
1: 0
2: 12
3: 124
4: 449
Right 1041250550 8:55930155-55930177 TCACGGATGCTAAAAAGGTTGGG No data
1041250540_1041250547 14 Left 1041250540 8:55930113-55930135 CCTGACCCCGCTCTGTGGAAAAA 0: 1
1: 0
2: 12
3: 124
4: 449
Right 1041250547 8:55930150-55930172 ACCAGTCACGGATGCTAAAAAGG No data
1041250540_1041250549 18 Left 1041250540 8:55930113-55930135 CCTGACCCCGCTCTGTGGAAAAA 0: 1
1: 0
2: 12
3: 124
4: 449
Right 1041250549 8:55930154-55930176 GTCACGGATGCTAAAAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041250540 Original CRISPR TTTTTCCACAGAGCGGGGTC AGG (reversed) Intronic
900035033 1:400597-400619 ATTTTCCATTTAGCGGGGTCTGG + Intergenic
900056651 1:636349-636371 ATTTTCCATTTAGCGGGGTCTGG + Intergenic
900711893 1:4119683-4119705 TTTCTCCAGGGAGCGGGGTGGGG - Intergenic
901578984 1:10224891-10224913 TTTTTCCACAGACAGGGTTGGGG + Intronic
901895286 1:12306749-12306771 TTTTTCCACAGACAGGGTTGGGG + Intronic
902703542 1:18189413-18189435 TTTTTCCACAGACCAGGGCAGGG + Intronic
903088360 1:20884898-20884920 TTTTTCCACAGACCAGGGTTGGG + Intronic
903701936 1:25255559-25255581 TTTTTCCACAGCTGGGGGTGGGG + Intronic
903703867 1:25270560-25270582 TTTTTCCATGGACCGGGGTGAGG - Intronic
903723375 1:25422764-25422786 TTTTTCCATGGACCGGGGTGAGG + Intronic
904353054 1:29921374-29921396 TTTTTCCACAGACGGGGGTGGGG + Intergenic
905204509 1:36335543-36335565 TTTTTCCCCAGTGGGGGCTCTGG - Intergenic
905688946 1:39928647-39928669 TTTTTCCACAGACTGGGGTGCGG - Intergenic
905802315 1:40852626-40852648 TTTTTCTGCAGAGCGGAATCTGG - Intergenic
905998260 1:42401035-42401057 TTTTTCCACAGATGGGGGTGGGG + Intronic
906390500 1:45411313-45411335 TTTTTCCACAGACTCGGGTGAGG + Intronic
907017558 1:51032121-51032143 TTTTTCCGCAGGGCGGGGGGTGG + Intergenic
907495778 1:54843339-54843361 TTCTTCCACAGACCAGGGTAGGG - Intergenic
907828050 1:58037638-58037660 TTTTTCCATGGAGCAGGGTGGGG - Intronic
908287825 1:62628059-62628081 TTTTTCCACAGATGGGGTTGTGG + Intronic
908343437 1:63206292-63206314 TATTTCCACAGACCGGAGTCGGG - Intergenic
909363584 1:74793707-74793729 TTTTTCCACAGAGCACTGCCTGG + Intergenic
910411933 1:86955455-86955477 TTTTTCCACAGGGGGTGGGCGGG - Intronic
910621482 1:89260074-89260096 TTTTTCCACAGAGGGTTGGCGGG + Intronic
911719729 1:101177818-101177840 TTTTTCCACAGAGTGGGTTGGGG - Intergenic
911903125 1:103530062-103530084 TTTTTCCACAGGCTGGGGTGGGG - Intronic
913343245 1:117781224-117781246 CTTCCCCAGAGAGCGGGGTCAGG - Intergenic
914319901 1:146549112-146549134 TTTTTCCACAGATTGGGGGTGGG - Intergenic
914381079 1:147117054-147117076 TGTTTCCACAGAGCAAGGTTGGG - Intergenic
915962076 1:160275282-160275304 GTTTTCCACAGAGGGGGGTGGGG - Intergenic
916619212 1:166477564-166477586 TTTTTCCACAGAGTGGGGTGGGG + Intergenic
917169654 1:172157006-172157028 TTTTTCCACAGATCAGGATGAGG + Intronic
917780707 1:178393155-178393177 TTTTTCCACGGACCAGGGTTGGG + Intronic
917850621 1:179060632-179060654 ATTTTCCACAGACAGGGGTTGGG - Intronic
918041330 1:180915938-180915960 TTTTTCCATGGATCGGGGGCGGG - Intronic
919852611 1:201683370-201683392 TTTTTCCACGGACAGGGGTTGGG + Intronic
920524324 1:206655608-206655630 TTATCCCACAGACTGGGGTCTGG - Intronic
921151862 1:212409138-212409160 TTTTTCCACAGATGGAGGTTGGG - Intronic
921322423 1:213954907-213954929 TTTTTCCACAGACCGGGGTGGGG + Intergenic
921638787 1:217527217-217527239 TTTTTCCACAGACTGGGGGTAGG - Intronic
922111827 1:222566349-222566371 TTTTTCCACAGACCAGTGTGAGG + Intronic
922257561 1:223906154-223906176 ATTTTCCATTTAGCGGGGTCTGG + Intergenic
922501686 1:226101596-226101618 TTTTTCCACAGACTGGGGTAAGG - Intergenic
922607853 1:226902096-226902118 TTTTTCCACAGATAGGGGTTGGG + Intronic
922865349 1:228856021-228856043 TTTTTCCACAGACCAGGGATGGG - Intergenic
923328558 1:232901685-232901707 ATTTTCCAGAGAGAGGGGTGTGG - Intergenic
924338755 1:243008934-243008956 ATTTTCCATTTAGCGGGGTCTGG + Intergenic
924375517 1:243403915-243403937 TTTTTCCACGGACCAGGGTAGGG - Intronic
1063499456 10:6539680-6539702 TTTTTCCACAGACTGGGGTGGGG - Intronic
1064020251 10:11803396-11803418 TTTTTCTACAGAGGAGGGTGGGG + Intergenic
1064310395 10:14207289-14207311 TTTTTCCACGGATGGGGGTGGGG + Intronic
1064368154 10:14726810-14726832 TTTTTCCACAGACCAGGGTGTGG + Intronic
1064449901 10:15432312-15432334 TTTTTCCACAGACCGGTGGGCGG - Intergenic
1064605038 10:17030288-17030310 TTTTTCCACGGACCGGGGGTGGG - Intronic
1065284371 10:24173454-24173476 TTTTTACACAGACGAGGGTCAGG - Intronic
1065631417 10:27684789-27684811 TTTTTCCACAGACCGGGGAGCGG + Intronic
1065672561 10:28136280-28136302 TTTTTCCACAGATGGGGGTTTGG - Intronic
1065679094 10:28210678-28210700 ATTTTCCACAGAGCAGGCTTTGG - Intronic
1065755582 10:28927600-28927622 TTTTTCCACAGACCCAGGACAGG + Intergenic
1065939563 10:30551759-30551781 TTTTTCCACAGACTGGGGTGGGG + Intergenic
1068017882 10:51541106-51541128 TTTTTCCACAGAGCAGGGTTGGG + Intronic
1068194130 10:53694380-53694402 TTTTTCCACAGACGGGGGTAGGG + Intergenic
1068505149 10:57891081-57891103 TTTTTCCACAGATGGTGGTGGGG - Intergenic
1068959219 10:62849878-62849900 TTTTTCCACAGATGGGGGCTGGG - Intronic
1069136509 10:64773160-64773182 TTTTTCCTCAGACAGGGGTGGGG - Intergenic
1069218616 10:65854412-65854434 TTTTTCCACAGATTGGGGGTTGG + Intergenic
1069572348 10:69501983-69502005 TTTTTCCACAGGATGGGGTGCGG - Intronic
1070222435 10:74463193-74463215 ATTTTCCACAGGGCAGGGTGGGG + Intronic
1071722116 10:88157601-88157623 TTTCTCCCCAGTGTGGGGTCAGG - Intergenic
1072056051 10:91756958-91756980 TTTTTCCACAGATGGGGATGGGG + Intergenic
1072332697 10:94369234-94369256 TTTTTCCACAGATCAGGGTGGGG + Intergenic
1073642966 10:105271478-105271500 TTTTTCCACAGACAGGGGGCAGG + Intergenic
1074069590 10:110052559-110052581 TTTTTCCACAGACTGGGGGTCGG - Intronic
1074124555 10:110517683-110517705 TTTTCCCACAGACGGGGTTCGGG - Intergenic
1074507495 10:114084568-114084590 TTTTTCCAAAGACCAGGGTAGGG + Intergenic
1076048770 10:127315706-127315728 CTTTTCCACATAGCTGGGTTGGG + Intronic
1076057372 10:127386768-127386790 TTTTTCCATGGACCGGGGTGGGG - Intronic
1076284900 10:129285309-129285331 TTCTTCCACACACTGGGGTCAGG + Intergenic
1077643423 11:3902418-3902440 TTTTTCCACAGACCAGGGTGCGG + Intronic
1077860845 11:6178479-6178501 TTTTTCCACAGACAGGGGAAGGG - Intergenic
1078342775 11:10511416-10511438 TTTTTCCACAGACCAGGGTTGGG - Intergenic
1078531475 11:12139749-12139771 TTTGTCCACAGAGGAGGGTCAGG + Intronic
1078592278 11:12653551-12653573 TTTTTCCACAGACCAAGGTAGGG + Intergenic
1079470700 11:20774643-20774665 TTTGTCCACAGTGCTGGTTCAGG + Intronic
1080046016 11:27809148-27809170 TTATTCCACAGACTGGGGTTGGG + Intergenic
1080242877 11:30147242-30147264 TTTTTCCACAGATGGGGGTGGGG + Intergenic
1080454514 11:32406208-32406230 TTTTTCCACAGACCAGGGGTGGG + Intronic
1080466494 11:32502370-32502392 TTTTTCCACAGACCAGGGGGTGG - Intergenic
1080470232 11:32538354-32538376 TTTTTCCATGGATGGGGGTCGGG + Intergenic
1080492595 11:32782302-32782324 TTTTTCCACAGACTGGGGCTGGG - Intronic
1080723650 11:34873284-34873306 TTTTTCCACAGATGGGGGCAGGG - Intronic
1080739975 11:35054849-35054871 TTTTTCCATGGAGCAGGGGCAGG - Intergenic
1080878526 11:36298252-36298274 TTTTTCCACAGACCAGGGTAGGG + Intronic
1080903135 11:36514433-36514455 TTTTTCTACAGAGCAGAGTGGGG + Intronic
1081262397 11:40976845-40976867 TTTTTCCACAGACTGGGGCAGGG + Intronic
1082841385 11:57692951-57692973 TTTTTCCACAGATGGGGGCTGGG + Intronic
1083576676 11:63796900-63796922 TTTTTCCACAGACAGGGTTGGGG + Intergenic
1084056560 11:66637871-66637893 TTTTTTCTCAGGGTGGGGTCGGG + Intronic
1084946889 11:72643141-72643163 TTTCTCCGCAGAGCGGCTTCTGG + Intronic
1087379543 11:97386932-97386954 TTTTTCCACAGAGAGCGTTGCGG + Intergenic
1087428393 11:98019182-98019204 TTTTTCCACAGACTGGTGTTGGG + Intergenic
1087454850 11:98372113-98372135 TTTTTCCACAGACCAGGGTTGGG + Intergenic
1089181389 11:116585386-116585408 TTTTTCCACAGACCAGGGTGGGG - Intergenic
1089616900 11:119699898-119699920 TTTTTCCACAGAGCTAGACCTGG - Intronic
1090591132 11:128270210-128270232 TTTTTCCACAGATTGGGGGTGGG - Intergenic
1090704825 11:129326689-129326711 TTTTTCCACAGACCAGGGGGTGG + Intergenic
1090981554 11:131726882-131726904 TTTTTCCACAGAGACGGGGCTGG + Intronic
1091541612 12:1467590-1467612 TTTTTCCACAGACAGGGGAGTGG + Intronic
1091942281 12:4498715-4498737 TTTTTCCACAGACTGGAGTTGGG + Intronic
1091942606 12:4501818-4501840 GTTTTCCACAGACCGGGGGTTGG - Intronic
1093176365 12:15917734-15917756 TTTTTCCACAGACTGGGGTAGGG + Intronic
1093224537 12:16465777-16465799 TTTTTCCACAGATTGGGGTGGGG - Intronic
1093661966 12:21767579-21767601 TTTTTCCACTGATGGGGGTGGGG - Intronic
1093766841 12:22973514-22973536 TTTTTCCACAGATGAGGGTGGGG + Intergenic
1094645745 12:32322378-32322400 TTTTTCCACAGATAGGGTGCGGG + Intronic
1096184876 12:49572305-49572327 TTTTTCCACAGACAGGGGGTTGG + Intronic
1097166701 12:57089835-57089857 TTTATTCACAGAGCGGGGAGGGG + Intronic
1097637991 12:62145448-62145470 TTTTTCCACGGACGGGGGTGCGG - Intronic
1097897236 12:64837252-64837274 TTTTTCCACAGACCAGGGCTTGG + Intronic
1098606706 12:72399173-72399195 TTTTTCCACAGACAGAGGTGGGG - Intronic
1098925291 12:76342579-76342601 AATTTCCACAGTGCAGGGTCTGG - Intergenic
1099222241 12:79929051-79929073 TTTTTCCACAGATGTGGGTTGGG + Intronic
1099536048 12:83846321-83846343 TTTTTCCACAAACTGGGGTTAGG + Intergenic
1099747994 12:86732311-86732333 TTTTTTCACAGACCGGGGTGGGG + Intronic
1100324817 12:93530951-93530973 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1100993685 12:100279150-100279172 TTTTTCCACAGATGGGGGATGGG + Intronic
1101749057 12:107567843-107567865 TTTTTCCACAGACTGGGGGTAGG - Intronic
1101955899 12:109212297-109212319 TTTTTCCACGGACCGGGGAGGGG + Intronic
1102919374 12:116780286-116780308 TTTTTCCACAGATCAGGGTGGGG + Intronic
1103860059 12:124005040-124005062 TTTTTCCACAGACTGGGGGCAGG - Intronic
1104650638 12:130529742-130529764 GTTTTCCACAGACTGGGGTGGGG + Intronic
1104680290 12:130746482-130746504 TTTTCCCACAGACCGAGGTGGGG + Intergenic
1104946659 12:132417661-132417683 GCTTCCCACAGAGCTGGGTCCGG - Intergenic
1105983977 13:25547668-25547690 TTTTTCCACAGACTTGGGTGGGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106457186 13:29937669-29937691 TTTTTCCACAGATGGGGTCCGGG - Intergenic
1107446219 13:40472314-40472336 TTTTTCCATAGACTGGGGTTGGG - Intergenic
1107593606 13:41937192-41937214 TTTTTCCACAGACTGGGGGGAGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108318162 13:49258613-49258635 ATATTCCACAGAGCAGGGACTGG - Intronic
1108320103 13:49281410-49281432 TTTTTCCACAGATGGGGTTATGG + Intronic
1108648696 13:52454980-52455002 TTTTTCCACTGAGAGGTGACAGG - Intergenic
1109066138 13:57694898-57694920 TGTGTCCAAAGAGCTGGGTCAGG + Intronic
1109176702 13:59166574-59166596 TTTTTCCACAGACTGGGGGGTGG - Intergenic
1111591399 13:90352213-90352235 GCTATCAACAGAGCGGGGTCTGG - Intergenic
1112222684 13:97507042-97507064 TTTTTCCACAGACCATGGTTGGG - Intergenic
1113881235 13:113627825-113627847 TTTTTCCACAGACCGGAGTCGGG - Intronic
1114028530 14:18554061-18554083 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1116423755 14:44764793-44764815 TTTTTCCACAGATCAGGGGTGGG - Intergenic
1117706537 14:58475397-58475419 TTTTTCCACAGACCAGGGCAGGG - Intronic
1118187975 14:63554778-63554800 TTTTTCCACTGACTGGGGTGTGG + Intergenic
1118620719 14:67611760-67611782 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1118710228 14:68512840-68512862 ATTTTACACACAGTGGGGTCAGG + Intronic
1119203753 14:72778602-72778624 TTTTTCCACCGACTGGGGTCGGG - Intronic
1120483890 14:85086029-85086051 TATTTCCAGAGAGCAGGATCAGG - Intergenic
1120680626 14:87476957-87476979 TTTTTCCATAGACCGGAGTAGGG + Intergenic
1120919552 14:89742490-89742512 TTTTTCCATGGACTGGGGTCAGG + Intergenic
1121284994 14:92728182-92728204 TTTTTCCACACACAGGGGTGAGG + Intronic
1121358123 14:93231896-93231918 TTTTTCCACGGACAGGGGTCGGG - Intergenic
1122170002 14:99864979-99865001 TTTTTCCACAGAAGTGGGGCGGG + Intronic
1122825969 14:104370617-104370639 TCTTTCCACAGCGCGGGGTGTGG + Intergenic
1123065053 14:105614489-105614511 TTTTTCCACAGACCAAGATCGGG - Intergenic
1123069253 14:105633924-105633946 TTTTTCCACAGACCAGGATCGGG - Intergenic
1123088353 14:105729716-105729738 TGTTTCCACAGACCAGGATCGGG - Intergenic
1123094301 14:105759084-105759106 TTTTTCCACAGACCAGGATCGGG - Intergenic
1124619405 15:31265325-31265347 TTCTGCCACAGAGAGAGGTCTGG + Intergenic
1124917866 15:33994507-33994529 TTTTTCCACAGACCAGGGTGAGG - Intronic
1124951297 15:34323578-34323600 TTTTTCCACAGACTAAGGTCGGG - Intronic
1125468384 15:39977248-39977270 TTTTTCCACAGACGGGTGTTAGG + Intronic
1126524118 15:49631160-49631182 TTTTTCCACAGACCAGGGTTTGG - Intronic
1126704214 15:51392590-51392612 TTTTTCCATAGACCGGGGTGTGG - Intronic
1128668551 15:69557008-69557030 TTTTTCTGCAGAGGGTGGTCAGG + Intergenic
1128963295 15:72031137-72031159 TTTTTCCACAGACTGGGGGATGG - Intronic
1129279200 15:74470518-74470540 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1129406255 15:75320564-75320586 TTTTTCCACAGACGGGGTTGGGG - Intergenic
1129703119 15:77779324-77779346 TTTTTCCACAGCCCAGGGTTGGG + Intronic
1129735217 15:77957055-77957077 TTTTTCCACAGACGGGGTTGGGG + Intergenic
1130195731 15:81778701-81778723 TTTTTCCACAGACCAGGGCGGGG + Intergenic
1131325472 15:91439370-91439392 TTTTTTCACAGATCAGGGTCAGG + Intergenic
1131454612 15:92573384-92573406 TATTTCCACAGAGAGAGGCCGGG - Intergenic
1131714571 15:95094571-95094593 TTTTTCCACGGAACGGGGTTAGG + Intergenic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1133977310 16:10608491-10608513 TTTTTCCACAGATGGGGGTTGGG - Intergenic
1134128217 16:11630762-11630784 TTTTTCTAGAGACAGGGGTCGGG + Intronic
1134285920 16:12862173-12862195 TTTTTCCATGGACCGGGGTTAGG + Intergenic
1135868271 16:26125269-26125291 TTTTTCCACAGATGGGGGTGGGG + Intronic
1136545321 16:30951044-30951066 GTTTTCCACAGACAGGGATCTGG - Intronic
1139120400 16:64009375-64009397 TTTTTCCACAGACCAGAGTTGGG + Intergenic
1139174321 16:64669353-64669375 TTTTTCCACCGTGCGGGGCGGGG + Intergenic
1140013625 16:71160965-71160987 TTTTTCCACAGATTGGGGGTGGG + Intronic
1140522906 16:75597511-75597533 TTTTTCCACAGATCCGGGGTGGG + Intronic
1141327742 16:83078323-83078345 TTTTTCCACATATTGGGGACGGG + Intronic
1142618168 17:1148683-1148705 TTTTTCCACGGACCGGGGAAGGG - Intronic
1143279482 17:5741810-5741832 TTTTTCCACGGACGGGGGTGGGG + Intergenic
1143602016 17:7953208-7953230 TTTTTCCACAGACAGGGGTGCGG + Intergenic
1144523915 17:15973675-15973697 TGTTTCCACAGACCAGGGGCGGG - Intronic
1144713615 17:17419549-17419571 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1147916949 17:43893761-43893783 TTTTTCCACGGATCAGGGTGAGG - Intronic
1149140066 17:53421579-53421601 TTTTTCCACAGACTGGGGGAGGG - Intergenic
1149897533 17:60440597-60440619 TTTTTCCACAGATCGGAAGCAGG + Intergenic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1150119956 17:62592667-62592689 TTTTTCCATGGACCGGGGACAGG + Intronic
1150209052 17:63431740-63431762 TTTTTCCACAGACCAGGGCTGGG - Intergenic
1150806742 17:68325490-68325512 TTTTTCCACAGACAGGGGTTGGG - Intronic
1151026759 17:70686017-70686039 TTTTTCCACAGACCAGGGTAGGG - Intergenic
1151267386 17:72967222-72967244 TTTTTCTACAGAGCGGGGGATGG - Intronic
1151836712 17:76586649-76586671 TTTTTCCACGGAGGGGGGTGGGG + Intronic
1151945554 17:77318114-77318136 TTTTTCCACAGACCAGGGAGTGG - Intronic
1151984013 17:77530325-77530347 TTTTTCCACGGACCCGGGTGGGG + Intergenic
1152422327 17:80200617-80200639 CTTTTCCACAGACCGGGTTGTGG + Intronic
1152883376 17:82833188-82833210 CTTTTACACAGAGCGTGGGCTGG + Intronic
1152983683 18:303009-303031 TTATTTCACAGAGCTGGGTGTGG - Intergenic
1153377184 18:4393758-4393780 TTTTTCCACAGACCGGGGGCAGG + Intronic
1153529077 18:6025654-6025676 TTTTTCCACAGACAGGGGCTTGG + Intronic
1153533813 18:6078696-6078718 TTTTTCCACAGACCAGGGGTGGG + Intronic
1154045627 18:10902201-10902223 TTTTTCCACGGATGGGGGTAGGG - Intronic
1154112884 18:11585540-11585562 TTTTCCCAAAGAGTTGGGTCTGG + Intergenic
1154236241 18:12608956-12608978 TTTTTCCACAAATGGGGGTGGGG + Intronic
1155107965 18:22686525-22686547 TTTTTCCAAAGACCAGGGTCGGG + Intergenic
1155401866 18:25448058-25448080 TTTTTCCATGGAGCAGGGTGTGG - Intergenic
1156432832 18:37094018-37094040 TTTTTCCACAGACCAGGGTGTGG + Intronic
1157474062 18:48010189-48010211 TTTTTCCACAGACAGGGCACAGG - Intergenic
1157778096 18:50412628-50412650 TTTTTCCATGGACCGGGGTTGGG + Intergenic
1158130816 18:54150598-54150620 TTTTTCCAAAGAGCAGGGTGGGG - Intergenic
1158289500 18:55923387-55923409 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1158480903 18:57821058-57821080 TTTTTCCACAAACCAGGGTGGGG - Intergenic
1159014867 18:63093089-63093111 TTTTTCCACGGACAGGGGCCGGG - Intergenic
1159031133 18:63233462-63233484 TTTTTCCATAGACGGGGGTGGGG + Intronic
1159558320 18:69967854-69967876 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1159937272 18:74379242-74379264 TTTTTCCACAGACCAAGGTTGGG + Intergenic
1160213099 18:76900853-76900875 TTTTTCCACAGATTGGGGGTCGG + Intronic
1160245781 18:77158431-77158453 TTTTTCCATGGATGGGGGTCTGG + Intergenic
1160334260 18:78023491-78023513 TTTTTCCACAGACTGGGAGCGGG + Intergenic
1160398913 18:78594612-78594634 TTTTTCCACAGACTAGGGTAGGG + Intergenic
1160764381 19:800929-800951 TTTTGCCACAGGGCAGGGTTAGG + Intronic
1161997419 19:7721984-7722006 CTTTTCCACAGACTGGGGTGGGG + Intergenic
1162043050 19:7981960-7981982 TTCTGCCCCACAGCGGGGTCGGG - Intronic
1162833262 19:13299846-13299868 TTTTTCCACAGACCTAGGTGTGG + Intronic
1163054141 19:14705858-14705880 TTTTTCCACAAAGCAGGGTAGGG - Intronic
1163120966 19:15217469-15217491 TTTTTCCACGGACCGGGGTAGGG + Intergenic
1163208262 19:15820406-15820428 TTTTTCCACGGACTGGGGTTGGG + Intergenic
1163384170 19:16989203-16989225 TTTTTCCACAGACGGGGGCACGG - Intronic
1163511016 19:17734991-17735013 TATTTCTGCAGAGAGGGGTCAGG - Intergenic
1164579710 19:29427182-29427204 TTTTTCCACAGACCAGGGGAGGG - Intergenic
1164942590 19:32263102-32263124 TCTCTGCACAGAGAGGGGTCCGG + Intergenic
1165088191 19:33366036-33366058 TTTTTCCACAGATAGGGAGCAGG - Intergenic
1165242477 19:34479902-34479924 TTTTTCCACAGACAGGGATGGGG - Intergenic
1165410407 19:35657044-35657066 TTTTTCCACAGACAGGGTTGGGG + Intronic
1165671086 19:37679907-37679929 TTTTTCCACAGAGTAGGGACAGG + Intronic
1166582621 19:43915783-43915805 TTTTTCCACAGACTGGGGTCGGG - Intronic
1167998212 19:53423878-53423900 TTTTTCCACAGAGCTGCTCCAGG - Intronic
1167998636 19:53426770-53426792 TTTTTCCACAGATGGGGGGATGG - Intronic
1168007694 19:53504472-53504494 TTTTTCCACAGAGCTGCTCCAGG - Intergenic
1168008760 19:53512881-53512903 TTTTTCCACAGACGGGGGGATGG - Intergenic
1168254771 19:55159350-55159372 TTGCTCCACAGACCGGGGCCAGG - Exonic
925180524 2:1814277-1814299 TTTGTCCACAAAGCAGGGCCCGG + Intronic
925230614 2:2230618-2230640 ATTTTCCACAGCGTGGCGTCTGG - Intronic
926537012 2:14125547-14125569 ATTTTTCACAGAGCTGGGACTGG - Intergenic
927132221 2:20070361-20070383 TTTTTCCACGGACAGGGGTGGGG + Intergenic
927228062 2:20789875-20789897 TTTTTCCACAGACTGGGGAGGGG - Intronic
927259453 2:21072450-21072472 TTTTTCCACGGATGGGGATCGGG + Intergenic
928154722 2:28866381-28866403 TTTTTCCACAGACTGGGGAGAGG + Intronic
928208569 2:29305756-29305778 CTTTTCCACAGACCAGGGGCTGG + Intronic
929675160 2:43919251-43919273 TTTTTCCACAGACCAGGTTGTGG - Intronic
931377297 2:61718882-61718904 TTTCTCCACAGACTGGGGTGGGG - Intergenic
932206604 2:69888993-69889015 TTTTTCCACAGGATGGGGGCAGG + Intergenic
932725366 2:74175383-74175405 TTTTTCCACAGATCTGGTTGGGG - Intronic
932754826 2:74400053-74400075 TTTGTCCACAAGGAGGGGTCAGG - Intergenic
933652574 2:84861173-84861195 TTTTTCCACAGAGCAGGTGAGGG + Intronic
934625765 2:95849494-95849516 TTTTTCCACAGATGGGGGTTTGG + Intronic
934807807 2:97251824-97251846 TTTTTCCACAGATGGGGGTTTGG - Intronic
934829703 2:97505363-97505385 TTTTTCCACAGATGGGGGTTTGG + Exonic
935083544 2:99822825-99822847 TTTTTCCAGAGTTCGGGGTGGGG + Intronic
935554979 2:104499485-104499507 GTCCTCCACAGAGCTGGGTCTGG + Intergenic
935606049 2:104973132-104973154 CTTTTCTACTGAGCTGGGTCAGG - Intergenic
935891315 2:107681806-107681828 TTTTTCCACAGACCAGGGTGGGG + Intergenic
936631707 2:114210429-114210451 TTTTTCCACGGACGGGGGGCAGG + Intergenic
936773118 2:115938878-115938900 TTTTTCCAGAGAGGGAGGACTGG - Intergenic
937177713 2:119957513-119957535 TTTTTCCATGGAGTGGGGTTGGG - Intronic
939370427 2:141292235-141292257 TTTTTCCACAGACCGGGATGGGG - Intronic
941150199 2:161905226-161905248 TTTTTCCACAAAGAGGGTTGAGG + Intronic
942305148 2:174599931-174599953 TTTTTCCACGGAGTGGGGGCAGG + Intronic
943294327 2:186117593-186117615 TTTTTCCACAGACCGGAGGTGGG + Intergenic
943576249 2:189634071-189634093 TTTTTCCACAGACCAGGGGCCGG - Intergenic
944862757 2:203830427-203830449 TGTTTCCACAGAGCTGAGTTGGG + Intergenic
945260987 2:207843310-207843332 CTTTTTCTCAGAGAGGGGTCTGG - Intronic
945327602 2:208501025-208501047 TTTTTCCACTGACTGGAGTCAGG + Intronic
946463461 2:219890547-219890569 GTTGTCCACAGAGCTGGGTGTGG + Intergenic
946500720 2:220244675-220244697 TTTTTCCATGGACTGGGGTCGGG + Intergenic
946584558 2:221170253-221170275 TTTTTCCACAGACCTGGGGAAGG - Intergenic
946649471 2:221875249-221875271 TTTTTCCACGGATGGGGGTAGGG - Intergenic
947482411 2:230512659-230512681 TTTTTCCACAGACCGGGATGGGG + Intronic
947704593 2:232264026-232264048 TTTTTCCACAGACCAGGGGTAGG + Intronic
948394893 2:237638035-237638057 CTTTTCCACAGACCAGGGTGTGG + Intronic
948535788 2:238645685-238645707 TTTTTCCACAGACCGGGGAAGGG - Intergenic
948539807 2:238682526-238682548 TTTTTCCACAGATGGGGCTGGGG + Intergenic
949081535 2:242104487-242104509 TTTTTCCACAGACTGGGGCGAGG - Intergenic
1169138092 20:3209747-3209769 CTTTTCCACACAGCCGGGTCAGG - Intronic
1169166680 20:3430141-3430163 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1169640007 20:7741246-7741268 TTTTTCCACAGATAGTGGTGGGG + Intergenic
1169812541 20:9622788-9622810 TTTTTCCACAGACAGGGGTGCGG - Intronic
1170144345 20:13155885-13155907 TTTGTTCACAGATCTGGGTCAGG + Intronic
1170233820 20:14079912-14079934 TTTTTCCACAGACTGGGGGTAGG - Intronic
1170453318 20:16508441-16508463 TTTTTCCACAGATAGGGGTAGGG + Intronic
1170478340 20:16739477-16739499 TTTTTCCAGATGGCGGGGTCTGG + Intronic
1170501987 20:16983287-16983309 TTTTTCCACGGAGTGGGGGTGGG - Intergenic
1170979731 20:21200318-21200340 TTTTTCCATGGAGCGGGTTTAGG + Intronic
1171498722 20:25576917-25576939 TTTTGCCACAGAGCAAGGCCTGG + Intronic
1171567299 20:26207990-26208012 TTTTTCCACAAGGCGGTGCCCGG + Intergenic
1172757077 20:37293131-37293153 TTTTTCCACAGACCTGGGGGTGG + Intronic
1173051959 20:39571867-39571889 TTTTTCCACAGGTCGGGGTCGGG + Intergenic
1173204431 20:40981511-40981533 GTTTTCCACAGATTGGGGTAAGG - Intergenic
1173926017 20:46781819-46781841 TTTTTCCACAGATGGGGGCAGGG + Intergenic
1174455884 20:50648501-50648523 TTTTTCCACTGACCAGGGTGGGG + Intronic
1174635538 20:51996270-51996292 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1174906460 20:54557263-54557285 TTTTTCCACAGACGGGGTTGGGG + Intronic
1174958006 20:55122718-55122740 TTTTTCCATGGATCGGGGTGGGG + Intergenic
1175729242 20:61342206-61342228 TTTTTCCACAGATCAGGGGTAGG + Intronic
1176218977 20:63961141-63961163 TTTCTCCTCAAAGTGGGGTCTGG - Intronic
1176308531 21:5137054-5137076 TTTTTCCACAGACAGGGTTGGGG - Intronic
1178415933 21:32405117-32405139 TTTTTCCAAAGATGGGGGTTGGG + Intergenic
1178485560 21:33018013-33018035 TTTTTCCTCAGGGCAGGGTGCGG - Intergenic
1178958188 21:37041923-37041945 TTCTTCCACAGAGCTGAGTGTGG + Intergenic
1179046640 21:37850569-37850591 TTTTTCCACGGACCAGGGGCAGG - Intronic
1179598030 21:42456228-42456250 TTTTTCCACAAACCAGGGTGGGG + Intergenic
1179848528 21:44124978-44125000 TTTTTCCACAGACAGGGTTGGGG + Intronic
1179898074 21:44374381-44374403 TTTTTCCACAGATGGGGGCGGGG + Intronic
1180452651 22:15481111-15481133 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1181846829 22:25717009-25717031 TTTTTCCACAGACGGGGATGGGG - Intronic
1182482979 22:30621782-30621804 TCTTTCAAAAGAGCAGGGTCAGG - Intronic
1183756555 22:39772107-39772129 TTTTTCCACAGAACAGGGTGTGG + Intronic
1184571777 22:45329596-45329618 TTTGTACACAGAGCGGGGCCAGG - Intronic
1184623851 22:45706100-45706122 TTTTTCCATAGACAGGGGTGGGG - Intronic
1184706305 22:46215942-46215964 TTTTTCCACAGATGGGGGTGGGG - Intronic
1184735948 22:46397961-46397983 TTTATCTACAGAGCTGGGGCGGG + Intronic
1184883445 22:47327054-47327076 TTTTTCTGCAGACCGGGGTGGGG + Intergenic
1185337842 22:50278685-50278707 TCTTCCCACAGAGTGGCGTCCGG - Exonic
949395309 3:3608489-3608511 TTTTTCCACAGACCTGGGGAGGG - Intergenic
950761677 3:15235538-15235560 TTTTTCCACAGACTGGGGGGTGG + Intronic
950995233 3:17489009-17489031 TTTTTCCATGGACCGGAGTCCGG - Intronic
951434749 3:22648773-22648795 TTTTTCCATGGACCGGGGTGGGG + Intergenic
951551426 3:23878908-23878930 TTTTTCCACAGATGGGGGGTGGG - Intronic
951628194 3:24689879-24689901 TTTTTCCACGGAACTGGGTGGGG - Intergenic
952337886 3:32420766-32420788 TTGTTCCTCAGAACTGGGTCTGG + Intronic
953872561 3:46639952-46639974 TTTTTCCACAGACCAGGGTGGGG + Intergenic
953874378 3:46657658-46657680 TTTTTCCACAGACTAGGGGCGGG - Intergenic
954230848 3:49216199-49216221 TTTTTCCACAGACCAGGATACGG + Intronic
954505738 3:51070959-51070981 TTTTTCCACGGATCGGGGGGAGG - Intronic
954725033 3:52601310-52601332 TTTTTCCACAGACAGGGATGGGG + Intronic
954766079 3:52917811-52917833 TTTTTCTACAGACTGGGGTGGGG - Intronic
955917970 3:63925551-63925573 TTTTTCCACTGACCAGGGTTGGG - Intronic
955935954 3:64102679-64102701 TTTTTCCACAGACTGGGGCCAGG - Intronic
956198125 3:66674043-66674065 TTTTTCCACAGACCGGGGTGAGG - Intergenic
956335820 3:68162271-68162293 TTTTTCCACAGATGGGGTTGGGG + Intronic
956764427 3:72472457-72472479 TTTTCCCACAGACCGGGGTTGGG - Intergenic
958056509 3:88419228-88419250 TTTTTCCACAGACCAGGGGGTGG - Intergenic
959181649 3:102987680-102987702 TTTTTCCACGGACAGGGGTGGGG + Intergenic
959846844 3:111042727-111042749 TTTTTCCACAGACTAGGGTCAGG - Intergenic
960086138 3:113593461-113593483 TTTTTCCACAGACGGGGGTGGGG - Intronic
960286815 3:115839083-115839105 ATTTTCCACAGAACAGAGTCAGG - Intronic
960326367 3:116300719-116300741 TTTTTCCACAAACTGGGGTAGGG - Intronic
960589108 3:119348332-119348354 TTTTTCCATGGACCAGGGTCAGG - Intronic
960672909 3:120169343-120169365 TTTTTCCACAGATAGTGGTGGGG - Intronic
961491763 3:127261324-127261346 TGTTTCCACAGAGCAGGGCTTGG - Intergenic
962754335 3:138456753-138456775 TTTTCCCACAGACCGGGGGTGGG - Intronic
964792015 3:160461173-160461195 TTTGTCCACAGATCAGGGTTGGG - Intronic
965435753 3:168648896-168648918 TTTTTCCACAGACCGGGGTAAGG - Intergenic
965971171 3:174558330-174558352 TTTTTCCACAGACTGGGTACGGG + Intronic
966358440 3:179107448-179107470 TTTTTCCACAGACTGGGGTAGGG + Intergenic
966533659 3:181007790-181007812 TTTTTCCACAGACCGGAGGGAGG - Intergenic
966584235 3:181603737-181603759 TTTTTCCACAAACCAGGGGCAGG + Intergenic
969193284 4:5541404-5541426 TTATTTCAAAGAACGGGGTCAGG + Intergenic
969925939 4:10585926-10585948 TATTTCCACAGATGGGGGTGGGG + Intronic
970008854 4:11436670-11436692 TTTTTCCACAGACCCGGGTGGGG + Intergenic
970038808 4:11772502-11772524 TTTTTCCACAGACTGGGATGGGG + Intergenic
970620803 4:17816137-17816159 TTTTTCCACAGAGGGCGGGCTGG + Intronic
970690396 4:18612966-18612988 TTTTTCCACAGATGAGGGTTGGG + Intergenic
970900484 4:21152901-21152923 TTTTTCCACAGACAGGGTTGGGG - Intronic
970946431 4:21698227-21698249 TTTCTGCACAGCGCGGGCTCAGG + Intronic
971372189 4:26028424-26028446 ATTTTACACAGAGAGGGGACGGG + Intergenic
971384920 4:26133737-26133759 TTTTTCCATAGACTGGGGGCGGG - Intergenic
972744836 4:41922760-41922782 TTTTTCCACAGACGGGAGTAGGG - Intergenic
974556278 4:63452730-63452752 TTCTCCCAGAGAGAGGGGTCTGG - Intergenic
975133517 4:70851378-70851400 TTTTTCCACAGACCAGGGTAGGG - Intergenic
975441795 4:74419703-74419725 TTTTTCCACAGACCAGGGGGTGG + Intergenic
975960745 4:79901560-79901582 TTTTTCCACAGACCGGGGGGTGG + Intronic
976122692 4:81800310-81800332 TTTTTCCACGGACCAGGGTGTGG + Intronic
976327611 4:83790410-83790432 TGATTCCATAGAGCGGGGTGGGG + Intergenic
976705595 4:88015943-88015965 TTTTTCCACAGACCTGGGGTAGG + Intronic
977558855 4:98512348-98512370 TTTGTCCACAGAGCAAGCTCAGG + Intronic
978139842 4:105306123-105306145 CTGTTCCACAGAAAGGGGTCTGG + Intergenic
978754474 4:112287077-112287099 TTTTTCCACAGACTGGGGTTGGG + Intronic
979238361 4:118426305-118426327 ATTTTCCATTTAGCGGGGTCTGG - Intergenic
979835816 4:125366069-125366091 TTGTTCCACAGAGCAGGGTGGGG - Intronic
979971347 4:127139728-127139750 TTTTTCCAAGGACAGGGGTCTGG + Intergenic
980016668 4:127657913-127657935 TTTTTCCACAGACCAGGGTTGGG - Intronic
980656562 4:135794437-135794459 TTTTTCCACAGACTGGAGTGGGG + Intergenic
981000147 4:139821485-139821507 TTTTTCCACAGACCAGGGGTCGG - Intronic
981734740 4:147937071-147937093 TTTTTCCACCGATTGGGGTGGGG - Intronic
981786307 4:148483109-148483131 TTTTTCCACAGACTGGGGTGGGG - Intergenic
981988719 4:150889674-150889696 TTTTTCCACAAACTGGGGTTGGG - Intronic
982086302 4:151840211-151840233 TTTTTCCACAGACTGGGGGTGGG - Intergenic
982484443 4:155950856-155950878 TTTTTCCACGGACTGGGGTGTGG - Intronic
982896921 4:160942006-160942028 GTTTTCCACAGATGGGGGTGGGG + Intergenic
983139077 4:164125915-164125937 TTTTTCCACAGAATGGGGCAGGG - Intronic
984077148 4:175197254-175197276 TTTTCCCACAGAGTGGTATCAGG - Intergenic
984588670 4:181591786-181591808 TTTTTCCACAGACAGGAGTAGGG - Intergenic
985110400 4:186541783-186541805 TTTTTCCACAGGACAGGGTGGGG - Intronic
985143860 4:186872633-186872655 TTTTTCCACAGACCAGGGTGGGG - Intergenic
986952109 5:13101329-13101351 TTTTTCCATGGACCAGGGTCAGG - Intergenic
987133279 5:14879012-14879034 TTTTTCCACAGACTGGGGGCAGG - Intergenic
987580341 5:19782445-19782467 CTTTTCCACAGAGAGGAGTAAGG + Intronic
987865332 5:23528711-23528733 TTTTTCCACTGGCTGGGGTCGGG + Intergenic
988805553 5:34737132-34737154 TTTTTCCATAGACCAGGGGCCGG - Intronic
988808160 5:34759762-34759784 TTTTTCCACAGACCAGGTACGGG - Intronic
988911528 5:35848219-35848241 TTTTTCCACAAAGTGGGAGCAGG + Intergenic
989469154 5:41795058-41795080 TTTTTCCACAGACTGGGGGATGG + Intronic
989472488 5:41836559-41836581 TTTTTCCACAGATGGGGGTTGGG + Intronic
989799095 5:45513741-45513763 TTTTTCCACAGTCAGGGGTGGGG - Intronic
990148070 5:52785411-52785433 TTTTTCCACAGACCAGGGGTAGG + Intergenic
990568780 5:57056793-57056815 TTTTTCCACAGACCGGGTAGTGG - Intergenic
990612111 5:57468116-57468138 TTTTTCCACAGACTGGGGGGTGG + Intergenic
991095028 5:62730966-62730988 TTTTTCCACAGACCTGGGGTGGG + Intergenic
991316144 5:65309092-65309114 CTTTTCCACAGACCAGGGTGGGG + Intronic
991625241 5:68594298-68594320 TTTTTCCACAGATGGGGGTGGGG - Intergenic
991670075 5:69038397-69038419 TTTTTCCACAGATGGGGGGCAGG + Intergenic
993037265 5:82771423-82771445 TTTTTCCACAGACCAGGGACGGG + Intergenic
993840157 5:92867490-92867512 TTTTTCCACAGAACAGAGTTAGG - Intergenic
993855260 5:93066378-93066400 TTTTTCCACAGATGGGGGTTGGG - Intergenic
993954810 5:94219072-94219094 TTTTTCCACAGATGGGGGCGGGG + Intronic
994198821 5:96949494-96949516 TTTTTCCACAGACAGGGGTGTGG - Intronic
994314335 5:98314879-98314901 TTTTTTCAGAGAGAGGGTTCTGG - Intergenic
994453484 5:99974341-99974363 TTTTTCAACAGACCAGGGTTGGG - Intergenic
995225187 5:109692775-109692797 TTTTTCCACAGACAGGGGTGGGG + Intronic
995354428 5:111222714-111222736 TTTTTCCACAGACAGGGGGTGGG - Intergenic
995952458 5:117732533-117732555 TTTTTCCATAGACTGGGGTGGGG + Intergenic
996710861 5:126542371-126542393 ATTTTCCACAGAGCTGGGCATGG + Exonic
997052888 5:130403305-130403327 TTTTTCCACAGATAGGGTTGTGG - Intergenic
997272663 5:132554937-132554959 TTTTTCCACAGACAGGAGTGGGG + Intronic
997689357 5:135815196-135815218 CTTTTCCACAGAGAGGGGGAAGG + Intergenic
997693876 5:135846217-135846239 TTTTTCCAAAGACCAGGGTGGGG - Intronic
998915793 5:147010285-147010307 TTTTTCCACAGACTGGGGCAGGG + Intronic
999087955 5:148910330-148910352 TTTGTCCACAGTGCGTGGTGAGG + Intergenic
999193735 5:149767812-149767834 TTTTTCCACAGATGGGGTTGGGG + Intronic
999914905 5:156247873-156247895 TTTTTCCACGAAGCAGGGGCTGG - Intronic
1000814136 5:165899483-165899505 TTTTTCCACAGAACTGGGGAGGG - Intergenic
1000913447 5:167050399-167050421 TTTTTTCACAGACTGGGGTTGGG - Intergenic
1001205825 5:169762192-169762214 TTTTGCCACAGAGAAGGGACTGG - Intronic
1001225391 5:169940419-169940441 TTTTTCCACAGACCGGGAGGAGG + Intronic
1001468146 5:171987122-171987144 TTTTTCCACAGACCAGGCACGGG - Intronic
1002195642 5:177499558-177499580 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1002516528 5:179763137-179763159 TTGTTCCACAGTGCCAGGTCTGG - Intronic
1002738786 5:181418274-181418296 ATTTTCCATTTAGCGGGGTCTGG - Intergenic
1004000182 6:11590827-11590849 TTTTTCCACCGAGTGGGGTGTGG + Intergenic
1004121252 6:12824408-12824430 TTTTTCCACGGACCAGGGTAGGG - Intronic
1004157900 6:13186759-13186781 TTTTTCCACAGACCGGAGGTGGG + Intronic
1004949761 6:20655695-20655717 TTTTTCCACAGACCGGGGGTGGG - Intronic
1004971292 6:20913511-20913533 GTTTTCCACAGAGCTGGGGCAGG - Intronic
1006507497 6:34498935-34498957 TTTTTCCACAGACTGGGGTTGGG + Intronic
1006507505 6:34498963-34498985 GTTTTCCACAGACCAGGGTTAGG + Intronic
1008681620 6:53878267-53878289 TTTTTCCACAGACCAGTGTTGGG + Intronic
1008694140 6:54014415-54014437 TTTTTCCACAGATGGGGCTAGGG + Intronic
1008909360 6:56716801-56716823 TTTTTCCACAGACCAGGGTCAGG + Intronic
1008967488 6:57327852-57327874 TTTTTCCACGGACTGAGGTCGGG + Intronic
1009052196 6:58289654-58289676 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1011569915 6:88724547-88724569 TTTTTCCACAGACAGGGGAAGGG + Intronic
1011814529 6:91172991-91173013 TTTTTCCACAGAGGGTGGCTGGG + Intergenic
1011846163 6:91565700-91565722 TTTTTCCACGGACCAGGGTTGGG + Intergenic
1011934600 6:92759693-92759715 TTTTTCCACGGACTGGGGTTGGG - Intergenic
1013331502 6:109106200-109106222 TTTTTCCACGGACCTGGGTTAGG - Intronic
1013385490 6:109625680-109625702 TTTTTCCACAGACTGGGTTGTGG - Intronic
1013420911 6:109965947-109965969 TTTTTCCACAGACCAGAGACAGG - Intergenic
1013465819 6:110416039-110416061 TTTTTCCACAGACTGGGGATGGG + Intergenic
1013496230 6:110700342-110700364 TTTTTTCACATACCGGGGTTCGG - Intronic
1014010437 6:116469414-116469436 TTTTTCCACAGACAGGGGTGGGG + Intergenic
1014227010 6:118860789-118860811 TTTTTCCACAGACCAGAGTGGGG + Intronic
1014335755 6:120134067-120134089 TTTTTCCACAGACCTGGGGTTGG + Intergenic
1014403171 6:121015862-121015884 TTGTTCCACAGAGTGGGGATGGG - Intergenic
1014527589 6:122519455-122519477 TTTTTCCACAGACGGAGGTGGGG - Intronic
1014592884 6:123294455-123294477 TTTTTCCACAGCCTGGGGTCGGG + Intronic
1014830814 6:126100702-126100724 TTTTTCCACAGACAAGAGTCGGG + Intergenic
1015166915 6:130208813-130208835 TTTTTCCAAGGACAGGGGTCAGG - Intronic
1015230719 6:130912166-130912188 TTTTTCCACATACCGGGGTGGGG - Intronic
1015240868 6:131021930-131021952 TTTTTTCACAGACCAGGGCCGGG + Intronic
1015465583 6:133544778-133544800 TTTTTCCACAGATGGGGGCGGGG - Intergenic
1015832784 6:137387963-137387985 TTTTTCCACGGACCAGGGTGAGG - Intergenic
1017735546 6:157359662-157359684 TTTTTCCATAGACCAGGGTGCGG + Intergenic
1018489382 6:164276011-164276033 TTTTTCCACGGACCAGGGTAGGG - Intergenic
1019243892 6:170693826-170693848 ATTTTCCATTTAGCGGGGTCTGG - Intergenic
1019986278 7:4658553-4658575 TTTTTCCACAGACCAGAGTGGGG + Intergenic
1020187654 7:5971097-5971119 TTTTTCCATGGATTGGGGTCGGG + Intergenic
1020295263 7:6753673-6753695 TTTTTCCATGGATTGGGGTCGGG - Intergenic
1023049757 7:36240785-36240807 TTTTTCCGCAGACCTGGGTTGGG + Intronic
1023199699 7:37682991-37683013 TTTTTCCACAGACAGGGGTGGGG - Intergenic
1023728769 7:43170357-43170379 TTTTTCCACAGACAGGGGTGGGG - Intronic
1023877238 7:44293552-44293574 TTTTTCCACAGACTGGGGCAAGG + Intronic
1024335008 7:48197905-48197927 TGTTTACAGAGAGCGGTGTCTGG + Intronic
1024626628 7:51213446-51213468 TTTTTCCACAGACCAGGCTGGGG - Intronic
1025104906 7:56162807-56162829 TTTTTCCACGGATGGGGGTTGGG - Intergenic
1027398752 7:77786179-77786201 TTTTTCCACGGACAGGGGTTGGG + Intergenic
1027482724 7:78718778-78718800 TTTTTCCACGGACAGGGGTTGGG - Intronic
1027613555 7:80392805-80392827 TTTTTCCACGGATTGGGGTGGGG + Intronic
1028479811 7:91292459-91292481 TTTTTCCACAGATTGGGGTAGGG - Intergenic
1028653741 7:93178716-93178738 TTTTTCCACAAACCGGGGAGTGG + Intergenic
1028924178 7:96339714-96339736 TCTTTCCACAGACTGGGGCCAGG - Intergenic
1029066015 7:97849295-97849317 GTTTTCCAGGGAGTGGGGTCTGG - Intergenic
1030570140 7:111212734-111212756 TTGTTACACACAGTGGGGTCTGG + Intronic
1030661235 7:112221480-112221502 TTTTTCCACAGACTGGGTTTTGG + Intronic
1030845157 7:114400587-114400609 TGTTTCCACAGACAGGAGTCGGG + Intronic
1030989135 7:116279339-116279361 TTTTACAACAGACCAGGGTCAGG - Intergenic
1032116129 7:129118731-129118753 TTTTTCCACAGACCAGGGAGTGG - Intergenic
1034007696 7:147492108-147492130 TTTTTCTACAGACCAGGGTGGGG + Intronic
1034144089 7:148853046-148853068 TTTTTCCACAAAGAGGGGAGAGG + Intronic
1034899278 7:154897504-154897526 TTTCTCCACAGAGCTGGGCTGGG + Intergenic
1035504232 8:114334-114356 ATTTTCCATTTAGCGGGGTCTGG + Intergenic
1035539448 8:421277-421299 TTTTTCCACAGACTGGGGCGAGG - Intronic
1036586232 8:10126428-10126450 TTTTTCCACAGACTGGGGGCAGG + Intronic
1036966308 8:13301909-13301931 TTTTTCCACGGAGTTGGGTAGGG - Intronic
1037190403 8:16117951-16117973 TTTTTCCACAGACCAGGGATGGG - Intronic
1039114200 8:34074073-34074095 TTTTTCCACAGACTGGGGGCAGG + Intergenic
1039707634 8:40023506-40023528 TATCTCCACAGAGCTTGGTCTGG + Intergenic
1040808466 8:51422311-51422333 TTTTTCCACTGACCGGGGTGGGG - Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1041646534 8:60258517-60258539 TTTTTCCACAGACAGGGGGCAGG + Intronic
1042210532 8:66376204-66376226 CATTTCCACAAAGCGGTGTCTGG - Intergenic
1042210537 8:66376233-66376255 CATTTCCACAGAGCAGCGTCTGG - Intergenic
1042210539 8:66376262-66376284 TCATTCCACAGAGCAGTGTCTGG - Intergenic
1042210554 8:66376376-66376398 GACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210569 8:66376489-66376511 CACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210574 8:66376518-66376540 CACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210600 8:66376717-66376739 CATTTCCACAAAGCGGTGTCTGG - Intergenic
1042210605 8:66376746-66376768 CATTTCCACAGAGCAGCGTCTGG - Intergenic
1042210654 8:66377175-66377197 CACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210711 8:66377629-66377651 CACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210722 8:66377715-66377737 CATTTCCACAGAGCAGTGTCTGG - Intergenic
1042210734 8:66377801-66377823 CACTTCCACAGAGCGGTGTCTGG - Intergenic
1042210745 8:66377886-66377908 TACTTCCACAGAGCAGTGTCTGG - Intergenic
1043866828 8:85384162-85384184 TTTTTCCACAGACCGACGTGGGG - Intronic
1044064954 8:87687946-87687968 CTTTTCCACAGATGGGGGTTGGG + Intergenic
1044416417 8:91945187-91945209 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1044866360 8:96574875-96574897 TTTTTCCACTGACCGAGGGCAGG + Intronic
1045229784 8:100292964-100292986 TTTTTCCACAGATGGAGGTGGGG + Intronic
1045654927 8:104376942-104376964 TTTTTCTACAGACCGGGGGTTGG + Intronic
1046037744 8:108864471-108864493 TTTTTCCACGGAGCTGGGGTAGG - Intergenic
1046349334 8:112985974-112985996 TTTTTCCACAGATCGGGGGTGGG - Intronic
1046526671 8:115389676-115389698 TTTTTCCATGGACTGGGGTCAGG + Intergenic
1046579025 8:116068585-116068607 TTTTTCCCCACAATGGGGTCTGG - Intergenic
1048071831 8:131029365-131029387 TTTTTCCACAGACATGGGTGGGG - Intronic
1048723793 8:137358717-137358739 TTTTTCCACAGACCAGGGTTAGG - Intergenic
1048800185 8:138187852-138187874 TTTCTCCAGAGATCGGGGCCGGG - Intronic
1050604863 9:7290257-7290279 TTTATCCTCAGAGCTGGGTATGG + Intergenic
1050876577 9:10645808-10645830 TTTTACTACAGAGTGGGATCTGG - Intergenic
1051332123 9:16033690-16033712 TTTTTCCACAGACAGGGGGTGGG - Intronic
1051689605 9:19696236-19696258 TTTTTCCACAGACCGAGGTTGGG - Intronic
1051788622 9:20774142-20774164 TTTTTCCACACACCTGGGGCAGG - Intronic
1051849907 9:21494359-21494381 TTTTTCCATAGACCAGGGTGGGG + Intergenic
1052811402 9:33063793-33063815 TTTTTCCACAGATGGTGGTGGGG - Intronic
1053013401 9:34648037-34648059 TGTTTCCACAGGGTGTGGTCAGG + Intronic
1053329029 9:37187260-37187282 TTTTTCCATGGACAGGGGTCGGG + Intronic
1055602147 9:77931063-77931085 TTTTTCCAGGGATGGGGGTCGGG - Intronic
1055846376 9:80568554-80568576 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1056325218 9:85472287-85472309 TTTTTCCACAGACCAGGGCAGGG - Intergenic
1058014545 9:100015735-100015757 TTTTTCCACTGATCAGGGTGGGG + Intronic
1060345959 9:122815999-122816021 TTTTTCCACAGACTGGGGTTGGG + Intronic
1061467588 9:130794142-130794164 TTTTTCCACAGACTGGGGATGGG - Intronic
1061546458 9:131307676-131307698 TTTTTACAAACAGCGTGGTCAGG + Intronic
1203604080 Un_KI270748v1:43050-43072 ATTTTCCATTTAGCGGGGTCTGG - Intergenic
1185983776 X:4807933-4807955 TTGTTCCACAGACCAGGGTTGGG + Intergenic
1186996708 X:15131399-15131421 TTTTTCCACAGACGGGGGGTGGG - Intergenic
1187386240 X:18851339-18851361 GTTTTCCACAGACTGGGGTGGGG - Intergenic
1187386250 X:18851367-18851389 TTTTTCCACAGACTGGGGTCGGG - Intergenic
1188034132 X:25297581-25297603 TTTTTCCACGGAGAGGGGTGGGG + Intergenic
1188700197 X:33250210-33250232 TTATTCCACAGACAGGGGTTTGG + Intronic
1189642100 X:43084408-43084430 TTTTTCCACAGACCAGGGACGGG + Intergenic
1191764411 X:64681826-64681848 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1192224705 X:69220360-69220382 TTTTTCCACAGACCAGAGCCTGG + Intergenic
1192548699 X:72036091-72036113 TTTTTCCACAGATGGGAGTCAGG - Intergenic
1196274979 X:113756138-113756160 TTATTCCACACAGCAGGGTGTGG + Intergenic
1196902897 X:120403265-120403287 TTTTTCCACGGAATGAGGTCAGG + Intergenic
1196995124 X:121373828-121373850 TTGTTCCACAGAGATGGGCCCGG + Intergenic
1197808839 X:130423154-130423176 TTTTTCCACAAATGGGGGTGGGG - Intergenic
1198177849 X:134173202-134173224 TTATTCTACAGAGCGCTGTCGGG - Intergenic
1201241863 Y:11965120-11965142 TTTTTCCACAGACAGGGTTGGGG + Intergenic
1202386140 Y:24328097-24328119 ATTTTCCATTTAGCGGGGTCTGG - Intergenic
1202484646 Y:25342031-25342053 ATTTTCCATTTAGCGGGGTCTGG + Intergenic