ID: 1041253403

View in Genome Browser
Species Human (GRCh38)
Location 8:55956925-55956947
Sequence ATGCAAACACACTTAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041253403_1041253405 21 Left 1041253403 8:55956925-55956947 CCCTGCTCTAAGTGTGTTTGCAT 0: 1
1: 0
2: 2
3: 18
4: 192
Right 1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041253403 Original CRISPR ATGCAAACACACTTAGAGCA GGG (reversed) Intronic
904369541 1:30039901-30039923 GGGCAAACACATTTAGATCAAGG + Intergenic
906690201 1:47787546-47787568 ATGCAATCACAGCTAGAGGAGGG - Intronic
907427761 1:54391684-54391706 ACCCAAACACACAAAGAGCAGGG + Intronic
907614167 1:55907044-55907066 ATGCAGATACTCTTAGAGCAGGG + Intergenic
909058788 1:70854541-70854563 ATGAGAACACACTAACAGCAAGG - Intronic
909326769 1:74361577-74361599 ATGCAAACTCCCTAAGATCAGGG - Intronic
910252800 1:85215694-85215716 ATGCAAGCACAGTTATAGAAGGG + Intergenic
917304165 1:173609734-173609756 ATGGAATGACACTTGGAGCAAGG - Exonic
917615307 1:176737729-176737751 ATTCAAAGACCCTTGGAGCAAGG + Intronic
919002261 1:191847731-191847753 ATGAACAGACACATAGAGCAAGG + Intergenic
919107023 1:193166434-193166456 ATGAAAACACACTTAAGGCTGGG - Intronic
921211372 1:212902373-212902395 ATGGAAACAGAAATAGAGCAGGG + Intergenic
923720069 1:236459249-236459271 ATGCAAATACAAGTAGAGCACGG - Intronic
1065884932 10:30068601-30068623 AAGAAAACACAGTTAGGGCAGGG - Intronic
1069092685 10:64221022-64221044 ATGCAAACACAATGAGAAAATGG - Intergenic
1073621325 10:105051947-105051969 ATGCAACCAGACATACAGCATGG - Intronic
1073774740 10:106772827-106772849 AATGAAACACAATTAGAGCAGGG + Intronic
1076036610 10:127203783-127203805 GTGCACACACATTTAGAGTATGG - Intronic
1081924815 11:46816710-46816732 ATACACACACACTTAGAGAAAGG - Intronic
1083252742 11:61478745-61478767 ATCCAGGCACACTTAGAGGAGGG + Intronic
1085175051 11:74478571-74478593 ATGGAAACACACATAAAACAAGG - Intergenic
1085823863 11:79822082-79822104 CTGCAAAGACACTTAAAGCAGGG - Intergenic
1087069241 11:94060674-94060696 ATGCATTCACACTGAGAGAAGGG - Intronic
1087417823 11:97880627-97880649 ATGCAAACAAATTTTGATCATGG - Intergenic
1088302202 11:108371176-108371198 ATGAACACACACTTATATCATGG - Intronic
1089705399 11:120274159-120274181 ATGCACACAAACATAGAGCCTGG + Intronic
1089765099 11:120757453-120757475 AGGCAAAAAGACTTAGAGTATGG + Intronic
1089843952 11:121443635-121443657 TGCCAATCACACTTAGAGCATGG - Intergenic
1091678532 12:2509488-2509510 ATAGAAACACACTTAAAACAAGG - Intronic
1096269182 12:50150471-50150493 ATGCAAATACACTTGGAAAAGGG + Intronic
1097424444 12:59425293-59425315 ATGTAAGCTCACTGAGAGCAGGG - Intergenic
1098038439 12:66330528-66330550 ATACACACACACATAGAGAATGG - Intronic
1099897430 12:88666880-88666902 ATGGAAACTCATCTAGAGCAGGG + Intergenic
1102004184 12:109578431-109578453 ATGTGAACACACTTAGTGCCTGG - Intronic
1102106917 12:110333149-110333171 GAGAAAACACTCTTAGAGCAGGG - Intronic
1102128355 12:110504009-110504031 ATCTGAATACACTTAGAGCATGG + Intronic
1102228138 12:111243870-111243892 ATGCACACACACATACAGGAAGG - Intronic
1102524457 12:113501389-113501411 ATGCAAACACAATTGGTGCATGG + Intergenic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1107319818 13:39174418-39174440 ATGCATCCACCCTTAAAGCAGGG - Intergenic
1107495748 13:40924133-40924155 CTCCAAACACACTTAGAATAGGG + Intergenic
1107706244 13:43109280-43109302 ATGCAAGAACCTTTAGAGCAAGG + Exonic
1108945284 13:56015283-56015305 ATGAAAACACACTATGACCAAGG + Intergenic
1109053052 13:57508981-57509003 ATGCAAACAAACTTATTGAATGG - Intergenic
1109435105 13:62288656-62288678 ATGCACTCACACATAGAACAAGG + Intergenic
1109507231 13:63319699-63319721 ATGCAAAAAGACAAAGAGCAAGG + Intergenic
1109585875 13:64403082-64403104 ATACACACACACTTAGAATAAGG - Intergenic
1111844051 13:93487041-93487063 ATATACACACACTTACAGCAGGG + Intronic
1112845479 13:103637427-103637449 ATGCAAACAAGCTTAGAGCGAGG - Intergenic
1114137519 14:19868660-19868682 ATGCTAACTGACTCAGAGCATGG + Intergenic
1114594642 14:23900839-23900861 ATGAAAACATATATAGAGCAAGG - Intergenic
1115517106 14:34196475-34196497 ATGAAAATAGACTTAGACCAAGG - Intronic
1116204684 14:41848638-41848660 ATTCTAAAACACTTAGAGCCTGG + Intronic
1116307238 14:43273564-43273586 ATGCAAACACAATTACCACATGG + Intergenic
1117957275 14:61132231-61132253 ATGCCATCACCCTGAGAGCAGGG - Intergenic
1118344942 14:64931553-64931575 AGGCAAAAACCCTTAGGGCAAGG - Intronic
1118918511 14:70128568-70128590 ATGCAACCACTCTAAGAGAATGG - Intronic
1119765456 14:77184861-77184883 ATGCAGACAGATCTAGAGCAAGG - Intronic
1120535151 14:85685925-85685947 ATCAAACCACACTTAGAGGAAGG - Intergenic
1124154619 15:27214999-27215021 ATGCACACACACTACGAGGATGG + Intronic
1125020648 15:34982986-34983008 ATGGGATCAGACTTAGAGCACGG + Exonic
1125824666 15:42666227-42666249 TTGGAAACACATTTAGAGAATGG + Intronic
1126347509 15:47711588-47711610 AAGCAAACACTGTTAGAGTATGG - Intronic
1126949258 15:53862237-53862259 ATGCAGACAGACTTGGAACAAGG + Intergenic
1127390288 15:58499780-58499802 ATCCAACCTCACTTAGACCAGGG - Intronic
1128523224 15:68389341-68389363 ATGCAAATACACTTAGTGCTGGG + Intronic
1132612652 16:824953-824975 CTGCAAACATCCTCAGAGCAGGG - Intergenic
1134888962 16:17821578-17821600 GTGCAACCATATTTAGAGCAAGG + Intergenic
1135659701 16:24285202-24285224 ATGCAAAGTCCCTGAGAGCAGGG - Intronic
1136173359 16:28501883-28501905 ACTCACACACACTCAGAGCATGG + Intronic
1138925851 16:61590615-61590637 ATTCAAAGACACTTAGTTCAAGG + Intergenic
1139012856 16:62654320-62654342 ATACACACACACATAGAGCTGGG + Intergenic
1140773780 16:78230724-78230746 AGGCAAATTCACTTTGAGCAGGG + Intronic
1140887893 16:79260531-79260553 ATGGAAACACTATGAGAGCAGGG + Intergenic
1140893333 16:79303975-79303997 ATCCAAACACTCTTGGAGCCAGG - Intergenic
1146422956 17:32706436-32706458 ATGAAAATACACTTAAAGCCAGG + Intronic
1149294345 17:55248257-55248279 ATGCAAACACAATGGCAGCAGGG + Intergenic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1149478298 17:56982005-56982027 ATGCAAACACACTCAGGGAAAGG - Intronic
1150893906 17:69186862-69186884 ATGTAAACACCATTAGAGTAGGG + Intronic
1151081190 17:71331177-71331199 ATGAAAACACACTTAGAAAAAGG - Intergenic
1152524039 17:80877176-80877198 TTACAAGCACACTTAGACCAAGG - Intronic
1153794830 18:8611816-8611838 ATTCAACCACACTCAGAGTAGGG - Intronic
1157164348 18:45344530-45344552 ATGAAGAGACACTTAGAGCAGGG + Intronic
1160025257 18:75211070-75211092 ATGCAAACACATTTTGATCATGG - Exonic
1160075702 18:75674647-75674669 AAGCAACCACCCTTAGTGCAGGG - Intergenic
1162922380 19:13911019-13911041 ACAGAAACACACATAGAGCAAGG + Intronic
1164443684 19:28299581-28299603 CTGCAAACACACCAAGAGTAAGG + Intergenic
925101638 2:1251845-1251867 ATGCACACACACCCAGACCATGG + Intronic
925892693 2:8448618-8448640 ATGAAAACACACTTGGAGTTTGG + Intergenic
926054527 2:9766648-9766670 ATGTAAAAACACTCAGATCAGGG - Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
927136698 2:20102072-20102094 ATGGACACACACTCAGGGCATGG + Intergenic
927640101 2:24840709-24840731 CTGCAAGCCCACTTGGAGCAGGG + Intronic
928823158 2:35387572-35387594 AACCATACACACTCAGAGCAAGG - Intergenic
929681110 2:43994942-43994964 ATTCAAAGACACTTACAGGACGG + Intronic
930356101 2:50322452-50322474 ATGCAAACACATTTTAAACAAGG + Intronic
931285435 2:60828081-60828103 CTGCAAACTCCCTGAGAGCAGGG + Intergenic
933850113 2:86359435-86359457 ATAGAAACACACATAAAGCAAGG + Intergenic
934625309 2:95843873-95843895 ATGCAAACTAAAATAGAGCAGGG + Intronic
934808262 2:97257425-97257447 ATGCAAACTAAAATAGAGCAGGG - Intronic
934829247 2:97499761-97499783 ATGCAAACTAAAATAGAGCAGGG + Intronic
936956505 2:118027994-118028016 ATGCAGACACACAAAGAGTAAGG + Intergenic
939059256 2:137400309-137400331 ATGCAAACACACAAAAATCATGG - Intronic
941517109 2:166493754-166493776 ATGCAAACACCCACAGACCACGG + Intronic
941643857 2:168018844-168018866 ATCCAACCACACTAAGAGCAAGG + Intronic
946513912 2:220391047-220391069 ACACAAACACACCTAGAACAAGG + Intergenic
946733873 2:222734870-222734892 ATCAAAACACACTTAGAGCTGGG + Intergenic
947826691 2:233110521-233110543 ATGCACACACACACAAAGCAGGG - Intronic
948850917 2:240704932-240704954 AAGAAAACACACAGAGAGCAAGG - Intergenic
1169375249 20:5061713-5061735 ATACAAACCCACTGAGAGGATGG + Intergenic
1170791823 20:19514946-19514968 ATGAAGACCCACTTAGAGCAGGG + Intronic
1172408655 20:34706842-34706864 GTGGAAACACCCTTAGAGAATGG + Intronic
1173082825 20:39886174-39886196 ATGCAAACGCCCTGAGAGCCTGG + Intergenic
1174191093 20:48741284-48741306 ATGCAAGCAAACTGAGAGAAAGG - Intronic
1177201871 21:17966543-17966565 AGGGAAACACACTAAAAGCATGG + Intronic
1180156274 21:45978740-45978762 CTATAAACACACTTATAGCACGG + Intergenic
1182950797 22:34373856-34373878 AAGGAAAAACACTCAGAGCATGG + Intergenic
1184988537 22:48152682-48152704 ATGGAAGGCCACTTAGAGCAGGG + Intergenic
949095309 3:78656-78678 ATGCAAACACAGTCTGAGCTTGG + Intergenic
950308615 3:11936289-11936311 ATGCAAAAGCACCTAGCGCAAGG - Intergenic
951081721 3:18457964-18457986 ATGGAAGCACACTGAAAGCATGG + Intergenic
951083004 3:18475029-18475051 ATGGGAGCAAACTTAGAGCATGG - Intergenic
953068289 3:39495150-39495172 TTGCAAGCACACGTAGAACAAGG + Intronic
953237309 3:41117990-41118012 GGGTAAACACAATTAGAGCATGG + Intergenic
956774658 3:72555014-72555036 ATGCAGACACTCTGAGACCAGGG + Intergenic
959407774 3:105981472-105981494 CTGTAAACACACTTCTAGCAAGG - Intergenic
961259119 3:125585429-125585451 ATGAAGATACACTTAGAGCCAGG - Intronic
961556067 3:127697376-127697398 ATGCAAAAACACTTAGTGCCGGG - Intronic
966290659 3:178353942-178353964 ATGCAAGCACAGTTAGAGAAAGG + Intergenic
966702711 3:182873296-182873318 ATGCAAACACCCTTAGGTCTAGG - Intronic
967585582 3:191210342-191210364 GTGCAAACACATTGAGGGCAAGG + Intronic
969948651 4:10811083-10811105 ATGCAGACTCTTTTAGAGCAAGG - Intergenic
970094973 4:12453097-12453119 GTCCAAAAACACTCAGAGCAGGG - Intergenic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
974575300 4:63711840-63711862 AAGAAAAAACACTTAAAGCATGG - Intergenic
974929088 4:68340883-68340905 TTTCAAACACACTTAAAGCCTGG + Intronic
976951624 4:90839577-90839599 AGATAAACACACTTAAAGCAGGG - Intronic
979239241 4:118433839-118433861 ATGTAAACTCACTGAAAGCAAGG - Intergenic
982071561 4:151699826-151699848 ATGAAATCACATTTTGAGCAAGG + Intronic
982633156 4:157858047-157858069 TTGTAAACCCACTTAGAGCTAGG - Intergenic
983188283 4:164726022-164726044 AAGGAAACACACGTAGACCATGG + Intergenic
983450471 4:167904461-167904483 ATCCAAACTCACTTAGAGGTGGG + Intergenic
984135069 4:175926172-175926194 ATTCAAACACATTTAAAACATGG + Intronic
984348982 4:178567906-178567928 ATGCAATCACAAATACAGCATGG - Intergenic
984408064 4:179358941-179358963 ATGCAAACAGAATTAGAGCAAGG - Intergenic
985006679 4:185541310-185541332 ATGCAAATACACCAATAGCAAGG - Intergenic
985852532 5:2399044-2399066 ATCTAAACACACTTTGAGAAAGG + Intergenic
986722653 5:10570977-10570999 ACACAAACACACTTATACCAAGG - Intronic
987449174 5:18060768-18060790 CTCCAAACACACTCAGAGTAGGG - Intergenic
990820098 5:59829169-59829191 ATGCACACACACTTGTAACAAGG + Intronic
991384240 5:66067394-66067416 ATGAAACCACATTTTGAGCATGG - Intronic
998333323 5:141348579-141348601 ATGAAAATACACTGAGAGTATGG + Intronic
999614896 5:153412856-153412878 ATCTTAACACCCTTAGAGCAGGG - Intergenic
999918205 5:156287012-156287034 ATGTAAACACTCTGAAAGCATGG - Intronic
1000571030 5:162914138-162914160 TTGCAAAGACACTTATATCAGGG + Intergenic
1002782168 6:375375-375397 ATGAAAACACACTTTTAGCCAGG + Intergenic
1003189591 6:3862312-3862334 ATGGAAACACAGTAAGAACAGGG - Intergenic
1003413048 6:5882705-5882727 ATGCAAACTCCATGAGAGCAGGG - Intergenic
1003718046 6:8668713-8668735 AAGAAAACACACTTACAGAAAGG + Intergenic
1004329354 6:14707695-14707717 TTACAAACACACCTAGAGAAGGG + Intergenic
1006059411 6:31409302-31409324 ATACACACACACACAGAGCAAGG - Intronic
1007441725 6:41867010-41867032 CTGCAACCACACTTATAGGAGGG + Intronic
1009396468 6:63205650-63205672 ATGCAAACTCTTTAAGAGCAAGG + Intergenic
1009855721 6:69260359-69260381 ATGTAAATACACTTACAGCAGGG - Intronic
1010676847 6:78755398-78755420 ATGAAAATACCCTTAAAGCATGG + Intergenic
1011029522 6:82906762-82906784 ATACAAAGACACTTGAAGCAGGG - Intronic
1011118672 6:83925600-83925622 ATTCCAAAACACTTAGAACAAGG - Intronic
1011521116 6:88208072-88208094 ATGTGAACAAACCTAGAGCACGG - Intergenic
1012549194 6:100452358-100452380 ATGCAAACTCCATGAGAGCAGGG + Intronic
1016207788 6:141490861-141490883 ATGAAAAGATACATAGAGCAAGG + Intergenic
1017913507 6:158815042-158815064 GGGCAAACACACTTAAAGGATGG - Intronic
1017989255 6:159471893-159471915 ATCCAAAGATTCTTAGAGCAGGG + Intergenic
1019087777 6:169497911-169497933 ATGCAAAAAAACTGAAAGCAGGG + Intronic
1022143470 7:27513886-27513908 ATGCAGTCACTCTGAGAGCAAGG + Intergenic
1022402577 7:30053900-30053922 ATGAAAACACACATAAAACAAGG - Intronic
1023391269 7:39713897-39713919 TTCCAAAGACCCTTAGAGCATGG - Intergenic
1027858280 7:83541051-83541073 ATGCACACACCCTTAGGGGAAGG + Intronic
1031105555 7:117537898-117537920 CTGCAAACACATATATAGCAAGG + Intronic
1032931069 7:136671586-136671608 ATGAAAACACACATAGGGCCAGG - Intergenic
1034269315 7:149796001-149796023 ATGCAAACCCCCTGAGGGCAGGG - Intergenic
1035189530 7:157153656-157153678 ACGCAACCATTCTTAGAGCAAGG - Intronic
1037902828 8:22697695-22697717 ATGCAAACACCCTCTGAGAAGGG - Intergenic
1038191762 8:25328322-25328344 ATCCAAACAGACTGCGAGCAGGG + Intronic
1038968080 8:32598223-32598245 ATTGAAACACTGTTAGAGCAGGG + Intronic
1038991956 8:32877837-32877859 ATGTAAGCTCAGTTAGAGCAGGG + Intergenic
1040383254 8:46893409-46893431 ATGAAAACACACCCATAGCATGG + Intergenic
1041253403 8:55956925-55956947 ATGCAAACACACTTAGAGCAGGG - Intronic
1042580521 8:70273240-70273262 ATGCCAAAAAACTTAGAACAGGG + Intronic
1042691353 8:71502945-71502967 ATGCACACACAATTGTAGCAAGG + Intronic
1042709407 8:71699489-71699511 ATGCAAAGATTATTAGAGCATGG + Intergenic
1048754535 8:137722465-137722487 ATGCACACACACATATATCAGGG - Intergenic
1048777182 8:137960083-137960105 AAGCATACACACTTGGAGCCAGG + Intergenic
1049521463 8:143093541-143093563 ATGCAAAACCACGTACAGCAGGG - Intergenic
1052871527 9:33511933-33511955 CTCCAAACACACTTAGAATAGGG + Intergenic
1054736013 9:68750659-68750681 ATGCAAACTCATTGAGAACAGGG - Intronic
1057534251 9:95883467-95883489 ATGCGAAAACAGTTACAGCAGGG - Intronic
1057686077 9:97236021-97236043 CTCCAAACACACTTAGAATAGGG - Intergenic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1058875654 9:109242656-109242678 AAATAAACCCACTTAGAGCAAGG - Intronic
1060124616 9:121030981-121031003 ATACAAAAACACTTAGAAGAAGG + Intronic
1060433280 9:123569548-123569570 ATACACACACGCTTAGGGCAAGG + Intronic
1060745209 9:126126760-126126782 ATGCAAACACACAGAGTGCCAGG + Intergenic
1061910224 9:133718514-133718536 ATGCATATACACATAGAACAGGG + Intronic
1188602857 X:31990523-31990545 ATGCCAACAAACTTAGAGCAAGG - Intronic
1193000429 X:76556856-76556878 ATGCAAACACACAAAGAGTGAGG + Intergenic
1194045902 X:89003078-89003100 ATATAAACTCTCTTAGAGCATGG + Intergenic
1194071770 X:89333162-89333184 ATGAAAACTTACTTAAAGCAAGG - Intergenic
1194297135 X:92140709-92140731 CTGCCAACCCACTTATAGCAAGG + Intronic
1196058662 X:111384280-111384302 ATGCATACGCACTTAGATTAGGG - Intronic
1197424299 X:126276184-126276206 ATGCACACTAACTTAGAGAATGG - Intergenic
1200614654 Y:5365281-5365303 CTGCCAACCCACTTATAGCAAGG + Intronic
1200726018 Y:6668890-6668912 ATGAAAACTTACTTAAAGCAAGG - Intergenic