ID: 1041253404

View in Genome Browser
Species Human (GRCh38)
Location 8:55956926-55956948
Sequence AATGCAAACACACTTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041253404_1041253405 20 Left 1041253404 8:55956926-55956948 CCTGCTCTAAGTGTGTTTGCATT 0: 1
1: 0
2: 3
3: 13
4: 188
Right 1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041253404 Original CRISPR AATGCAAACACACTTAGAGC AGG (reversed) Intronic
906855279 1:49297923-49297945 AATGCAAACACACATGGCACAGG + Intronic
907614166 1:55907043-55907065 AATGCAGATACTCTTAGAGCAGG + Intergenic
909313431 1:74184628-74184650 AATTCATTGACACTTAGAGCTGG - Intronic
909326770 1:74361578-74361600 AATGCAAACTCCCTAAGATCAGG - Intronic
909703602 1:78553965-78553987 AAGGCAAACACACTCAGGGGAGG + Intergenic
910670368 1:89766650-89766672 AATGTAAATACACTGTGAGCAGG + Intronic
911581352 1:99636860-99636882 AAGGCAGACACACTGACAGCTGG + Intergenic
914742612 1:150477843-150477865 AATGCAAACACAATCAGAATGGG + Intergenic
915629725 1:157142894-157142916 AAAGAAAACACAATGAGAGCCGG - Intergenic
916788966 1:168107951-168107973 AATGCAAACAGACTAAGACAGGG - Intronic
919107024 1:193166435-193166457 AATGAAAACACACTTAAGGCTGG - Intronic
921211371 1:212902372-212902394 AATGGAAACAGAAATAGAGCAGG + Intergenic
922304496 1:224332308-224332330 AATGAAAACACACTGAGGCCAGG + Intergenic
922555531 1:226529464-226529486 AATGCAAACACACGAAGCGTAGG - Intergenic
923068552 1:230542119-230542141 AATGCAAAAACAATGATAGCAGG + Intergenic
1063033496 10:2260473-2260495 AATGGAAACCCACAGAGAGCAGG + Intergenic
1063961927 10:11313912-11313934 ACTGCAAACACACTCACTGCTGG - Intronic
1064587853 10:16856863-16856885 AATACAAAGACATTTAAAGCTGG + Intronic
1067175893 10:43945263-43945285 GAAGCAGACACACTTAGAGGAGG - Intergenic
1068912333 10:62391698-62391720 ATTGCATACACATTTACAGCAGG - Intronic
1070090839 10:73283519-73283541 AGTGCAAACACACTTAGAACTGG + Intronic
1072261968 10:93685757-93685779 AAAGTACACACACTTATAGCTGG + Intronic
1073512684 10:104052492-104052514 AATGCTAACAGACTGTGAGCAGG - Intronic
1073774739 10:106772826-106772848 AAATGAAACACAATTAGAGCAGG + Intronic
1073903824 10:108253508-108253530 AATGCAAACTCACTTGAATCTGG - Intergenic
1077935467 11:6780971-6780993 CATGCATACATGCTTAGAGCTGG - Intergenic
1078474719 11:11621000-11621022 CATGCACACACACTCTGAGCCGG + Intronic
1079730769 11:23936238-23936260 AATGCAAAAACACAAAGAGGTGG - Intergenic
1079900653 11:26179510-26179532 GATACAAACATACTCAGAGCAGG - Intergenic
1079914490 11:26351890-26351912 AATGCAAAGACAGGTAGAGAGGG + Intronic
1084211443 11:67625340-67625362 AATGCAAAAACACAAAGAGGTGG + Intergenic
1085823864 11:79822083-79822105 GCTGCAAAGACACTTAAAGCAGG - Intergenic
1086012885 11:82126434-82126456 AATGCACACACAATAAAAGCTGG - Intergenic
1086968043 11:93050711-93050733 AATGCATACAAACAGAGAGCAGG - Intergenic
1087069242 11:94060675-94060697 AATGCATTCACACTGAGAGAAGG - Intronic
1088659359 11:112029966-112029988 CAGCCAATCACACTTAGAGCAGG + Intronic
1089766859 11:120774318-120774340 AATACACACACACACAGAGCTGG - Intronic
1089817866 11:121192567-121192589 AAAGAACACACACTTAGAGCAGG - Intergenic
1090919414 11:131194957-131194979 CTGGCAAACACACTGAGAGCGGG - Intergenic
1092472756 12:8793610-8793632 AATGCAAAAACACAAAGAGGTGG + Intergenic
1095243336 12:39887432-39887454 AATGAAAATACACCCAGAGCAGG + Intronic
1095853464 12:46834969-46834991 ACTACAAACACACTTAGTGATGG + Intergenic
1097424445 12:59425294-59425316 AATGTAAGCTCACTGAGAGCAGG - Intergenic
1097803009 12:63935872-63935894 AATTTAAACTCACTAAGAGCTGG - Intronic
1098440669 12:70513994-70514016 AATGAAAACTCACTAAGAGGAGG + Intergenic
1100119208 12:91348706-91348728 AATGGAAACACACCAAGAGGAGG + Intergenic
1100428345 12:94508380-94508402 AATGCAAACACACTAACACAGGG - Intergenic
1102106918 12:110333150-110333172 AGAGAAAACACTCTTAGAGCAGG - Intronic
1103205939 12:119128950-119128972 AATGGAAGCAAACTGAGAGCTGG + Intronic
1107121862 13:36804726-36804748 AATCCAAACACACCTCGTGCTGG - Intergenic
1107319819 13:39174419-39174441 AATGCATCCACCCTTAAAGCAGG - Intergenic
1107495747 13:40924132-40924154 ACTCCAAACACACTTAGAATAGG + Intergenic
1108087570 13:46809977-46809999 AATGAAAGCACTGTTAGAGCTGG - Intergenic
1111034476 13:82655044-82655066 AATGAAAACACAGCCAGAGCAGG - Intergenic
1111844050 13:93487040-93487062 AATATACACACACTTACAGCAGG + Intronic
1111999416 13:95196244-95196266 AATGCACAGAAAATTAGAGCAGG - Intronic
1112556562 13:100473705-100473727 AATGCAATCACTCTCGGAGCAGG - Intronic
1113128228 13:107004597-107004619 AATGCATAAACACCTGGAGCAGG - Intergenic
1113857696 13:113457449-113457471 AATGAAAACAAAAATAGAGCTGG + Exonic
1115257048 14:31414437-31414459 AGAGCAAACCCACTAAGAGCAGG + Intronic
1115795289 14:36928557-36928579 AATGCATGCACACTTAGGTCTGG + Intronic
1117057878 14:51931583-51931605 AGTGCAAACACTCTGAGACCTGG + Intronic
1119544014 14:75458990-75459012 AATGCAAAAAGATTCAGAGCTGG - Intronic
1119580663 14:75776948-75776970 AATGAAATCACTCTTAAAGCCGG + Intronic
1120888768 14:89472966-89472988 AATGCAAATGCATTTGGAGCAGG - Intronic
1123065065 14:105614587-105614609 AATGCAAAAACTCTTTGAGTTGG + Intergenic
1123088367 14:105729814-105729836 AATGCAAAAACTCTTTGAGTTGG + Intergenic
1123482865 15:20650608-20650630 AATGCATATACACTTAGTGTAGG - Intergenic
1126869614 15:52973790-52973812 AATGGAAAGACTCCTAGAGCAGG - Intergenic
1126872122 15:53001206-53001228 AATGCAAATACACTTAGGGCTGG + Intergenic
1128523223 15:68389340-68389362 TATGCAAATACACTTAGTGCTGG + Intronic
1129144581 15:73634938-73634960 AATACAAACATTCTGAGAGCTGG - Intergenic
1129984520 15:79905991-79906013 AATCCAAAACCACATAGAGCCGG + Intronic
1131786661 15:95920566-95920588 AATGCAAACTCAATGAAAGCAGG - Intergenic
1136555043 16:31002601-31002623 TCTGCACACACACTCAGAGCTGG + Intronic
1139012855 16:62654319-62654341 CATACACACACACATAGAGCTGG + Intergenic
1140773779 16:78230723-78230745 AAGGCAAATTCACTTTGAGCAGG + Intronic
1143202236 17:5121187-5121209 AATGCAAACAACCGCAGAGCAGG + Intronic
1146585788 17:34080424-34080446 AAGGGGAACAAACTTAGAGCTGG + Intronic
1149195483 17:54114616-54114638 AACTCAAACACACTTACAGATGG - Intergenic
1152905437 17:82968118-82968140 AATGCAAACACACGTCCATCCGG + Intronic
1153794831 18:8611817-8611839 AATTCAACCACACTCAGAGTAGG - Intronic
1154235644 18:12603291-12603313 AAAGCAAACACAGTTACAGACGG - Intronic
1156898395 18:42272833-42272855 AATGCAAACTGACGTAGAGGGGG - Intergenic
1157164347 18:45344529-45344551 GATGAAGAGACACTTAGAGCAGG + Intronic
1157409051 18:47448637-47448659 AATTCAAACTCTCCTAGAGCTGG - Intergenic
1159081748 18:63743016-63743038 AAAGAAAACACACATAGAGAGGG - Intergenic
1159289712 18:66400589-66400611 AATTCAAACACAGTTACAGAGGG + Intergenic
1161889976 19:7028010-7028032 AATGAAAACACACTTGAAACTGG - Intergenic
1161891476 19:7042736-7042758 AATGAAAACACACTTGAAACTGG + Intergenic
1161893561 19:7061193-7061215 AATGAAAACACACTTGAAACTGG + Intergenic
1162154947 19:8671316-8671338 AAAGAAAACACAGTAAGAGCTGG - Intergenic
1165509559 19:36258093-36258115 AACGCAGACACACATACAGCAGG - Intergenic
1168188748 19:54722338-54722360 AATGCCTACACACCTAAAGCTGG + Intergenic
926510987 2:13777675-13777697 AAAGCAAACACACTTACTACAGG - Intergenic
927074317 2:19562071-19562093 AATGCAAATAAAATCAGAGCAGG + Intergenic
927391236 2:22597810-22597832 AATTAAAACACACATAGAGACGG - Intergenic
930094736 2:47558513-47558535 AATGCCAACACACTCAGCACAGG + Intronic
931285434 2:60828080-60828102 ACTGCAAACTCCCTGAGAGCAGG + Intergenic
934625308 2:95843872-95843894 AATGCAAACTAAAATAGAGCAGG + Intronic
934808263 2:97257426-97257448 AATGCAAACTAAAATAGAGCAGG - Intronic
934829246 2:97499760-97499782 AATGCAAACTAAAATAGAGCAGG + Intronic
936048218 2:109202936-109202958 AATGCAAACACAATGGGAGCTGG + Intronic
938815393 2:134898480-134898502 AAACCAAACCCAATTAGAGCAGG - Intronic
939949554 2:148453078-148453100 AATGTAAACACTCTAAGAGCAGG - Intronic
940428225 2:153554930-153554952 AATGCAAACTCTGTTAGAGCAGG + Intergenic
941877935 2:170453983-170454005 AATGCAATTACACTTACAGAGGG + Intronic
942216497 2:173725299-173725321 AATGAAAAGACACTTAGAAAGGG + Intergenic
942871198 2:180736302-180736324 AATGCAAACGTACTTAGATAGGG + Intergenic
944729432 2:202502246-202502268 AATGCAAAAACACAAAGAGGTGG + Intronic
946578331 2:221100591-221100613 AATGCAAACACACTGACTTCTGG - Intergenic
946733872 2:222734869-222734891 CATCAAAACACACTTAGAGCTGG + Intergenic
946813931 2:223556308-223556330 AATGCAAATGCATTAAGAGCAGG - Intergenic
947253983 2:228141164-228141186 AATGCCAACACACTAGGAACTGG - Intronic
1170791822 20:19514945-19514967 AATGAAGACCCACTTAGAGCAGG + Intronic
1174558081 20:51410738-51410760 CATTCTAACACACTTAGGGCAGG + Intronic
1179152861 21:38823273-38823295 AATGCAAAAACTCTTTGAGAGGG + Exonic
1183767519 22:39892928-39892950 AATGAACACACACTTAGGGCTGG - Intronic
949901741 3:8820813-8820835 AATGCAAACACACTTGGGAATGG + Intronic
951374088 3:21890988-21891010 AAAGCAAACCCACTTGGAACTGG + Intronic
952560280 3:34584627-34584649 ATTGCAACCACACTCAGAGATGG - Intergenic
952964508 3:38612802-38612824 AAAGCAGCCACACTTAGAACTGG - Intronic
956774657 3:72555013-72555035 AATGCAGACACTCTGAGACCAGG + Intergenic
959885578 3:111496176-111496198 AGTGGGAACACACTTAGAACAGG + Intronic
961556068 3:127697377-127697399 CATGCAAAAACACTTAGTGCCGG - Intronic
966388476 3:179427078-179427100 AATGCAAAGACACTGAGACTGGG - Intronic
970035480 4:11730205-11730227 ATTGCAAACAACCTTAGTGCTGG - Intergenic
970877787 4:20892757-20892779 AAAACAAACACACTTAGAAGCGG - Intronic
972952064 4:44339323-44339345 ATTCCAAACATACTGAGAGCAGG + Intronic
974352342 4:60765373-60765395 ACTGAAAAGACAGTTAGAGCTGG - Intergenic
976409668 4:84698982-84699004 AAAGAAAACACACTTGGGGCTGG - Intronic
980648184 4:135673198-135673220 AATGCATACACAGTTAATGCAGG - Intergenic
981023840 4:140056138-140056160 ACTGCATACACACATGGAGCTGG - Intronic
981870296 4:149477606-149477628 AATGCAAACAGAAATGGAGCAGG + Intergenic
982632123 4:157843736-157843758 TATGCAAGCACACTAAGAACAGG + Intergenic
983450470 4:167904460-167904482 TATCCAAACTCACTTAGAGGTGG + Intergenic
989685433 5:44081191-44081213 AATGCAAGCACAATGAGGGCAGG - Intergenic
989740639 5:44766879-44766901 AATACAAACCCACTTTCAGCTGG + Intergenic
991033965 5:62109144-62109166 AAGGCAAACACATATAGAGTAGG - Intergenic
993289189 5:86042576-86042598 AATGCAAACACAATTAAGACAGG - Intergenic
994881263 5:105499592-105499614 ATTGCAAACACTTTAAGAGCAGG + Intergenic
995995658 5:118295328-118295350 ATTGCAGACACTCTTAGAGTAGG - Intergenic
996077230 5:119210380-119210402 AACTCAAAAACACTTAGAACAGG - Intronic
997783046 5:136679097-136679119 AATGCAAACCCCCAAAGAGCAGG + Intergenic
1003413049 6:5882706-5882728 AATGCAAACTCCATGAGAGCAGG - Intergenic
1004329353 6:14707694-14707716 ATTACAAACACACCTAGAGAAGG + Intergenic
1005765566 6:29008019-29008041 AAAGCAAAGACGCTTAGAGTTGG - Intergenic
1005982623 6:30848013-30848035 AATGAAGACACACGTAGGGCGGG + Intergenic
1006784383 6:36655599-36655621 AGCGCAGACACACTTAGTGCAGG + Intergenic
1007677535 6:43609420-43609442 AAGGCAAACAAGCTAAGAGCAGG - Intronic
1008228888 6:48959183-48959205 AATGAAAACAGACTGGGAGCAGG + Intergenic
1008377883 6:50811822-50811844 AATGCCAACACATTAAGAGTTGG - Intergenic
1009855722 6:69260360-69260382 AATGTAAATACACTTACAGCAGG - Intronic
1011111750 6:83845255-83845277 AATGTAAACACTGTGAGAGCTGG + Intergenic
1011125956 6:84008056-84008078 AATGCAGACTCACTTTGGGCTGG - Intergenic
1012549193 6:100452357-100452379 AATGCAAACTCCATGAGAGCAGG + Intronic
1014996032 6:128146011-128146033 AATGCAATCTCACTTACATCTGG + Intronic
1015105856 6:129535933-129535955 AACACAAACACACATAGAACTGG + Intergenic
1015887826 6:137937943-137937965 AATTCAAAGATACTTAGAGTTGG - Intergenic
1016763622 6:147767938-147767960 ACAGCAAACACATTTAGAACTGG + Intergenic
1019321560 7:417885-417907 TTTGCAACCACACTGAGAGCTGG - Intergenic
1020815646 7:12902245-12902267 AATGCAAACACTCTCTGAGTGGG + Intergenic
1020910864 7:14128778-14128800 AATCAAAAAACATTTAGAGCTGG - Intergenic
1023669520 7:42561100-42561122 AATGCAAACATAATCACAGCTGG - Intergenic
1024387205 7:48766252-48766274 AATGAGAGCACACTTTGAGCTGG - Intergenic
1024525547 7:50345879-50345901 AATGCAAAAAAATTTAGGGCCGG + Intronic
1027483167 7:78724742-78724764 TATGCCAACACACTTCCAGCTGG + Intronic
1031454992 7:121968603-121968625 AATAAAAAGACACTTAGAGAGGG - Intronic
1032065079 7:128762400-128762422 AATGCAAACACTTTTACATCTGG + Intronic
1032391074 7:131555967-131555989 CATGCAAACCCACTTAGCACCGG + Intronic
1033357704 7:140613854-140613876 AATGCAGACCAACTGAGAGCTGG + Intronic
1033439755 7:141367871-141367893 AATGCAAAGACCTTTAGAGCAGG + Intronic
1037278690 8:17211044-17211066 AATCAAAACAAACTTAAAGCTGG - Intronic
1037902829 8:22697696-22697718 AATGCAAACACCCTCTGAGAAGG - Intergenic
1038991955 8:32877836-32877858 AATGTAAGCTCAGTTAGAGCAGG + Intergenic
1039771917 8:40695670-40695692 AATTCAAACACCCTCAGATCTGG - Intronic
1041253404 8:55956926-55956948 AATGCAAACACACTTAGAGCAGG - Intronic
1041628492 8:60058597-60058619 AAGGCAAACACACTGAGGCCTGG - Intergenic
1042083126 8:65077509-65077531 AACGTAAACACACTTAGATAAGG + Intergenic
1047558815 8:125964272-125964294 ACGGCAACCACACTTTGAGCTGG + Intergenic
1048098346 8:131319180-131319202 AATGCAAACACCCTAAGATAGGG - Intergenic
1051972035 9:22900092-22900114 AATGGAAAAACATATAGAGCTGG - Intergenic
1052532256 9:29701734-29701756 AAACAAAACACACATAGAGCAGG + Intergenic
1052559355 9:30064474-30064496 ACTGCAAAGACACTATGAGCGGG + Intergenic
1052871526 9:33511932-33511954 ACTCCAAACACACTTAGAATAGG + Intergenic
1054736014 9:68750660-68750682 AATGCAAACTCATTGAGAACAGG - Intronic
1057208711 9:93187962-93187984 AAAGCCAACACACCTAGAGAAGG - Intronic
1057674610 9:97129007-97129029 AGGGCAAACTCACTTTGAGCAGG - Intergenic
1057686078 9:97236022-97236044 ACTCCAAACACACTTAGAATAGG - Intergenic
1058079468 9:100686881-100686903 AAAGCAAAGACACTTAGAGCTGG + Intergenic
1059572109 9:115450021-115450043 GATGCATACACACTTAGGTCTGG + Intergenic
1059760386 9:117331802-117331824 ACTGCAAAAACACTTAGGGAGGG + Intronic
1061910223 9:133718513-133718535 AATGCATATACACATAGAACAGG + Intronic
1186924095 X:14313171-14313193 AATGCAAACATTCTGTGAGCAGG + Intergenic
1188246859 X:27846596-27846618 GATGCATACACATTTAGAGTTGG + Intergenic
1190883979 X:54514499-54514521 AATTGAAACACACTAAGAACAGG + Intergenic
1191592049 X:62897185-62897207 AATGCAAACACACAAAAACCTGG + Intergenic
1194289349 X:92050069-92050091 AATTAAAACACACTGACAGCTGG - Intronic
1194938665 X:99982594-99982616 AATGCAAATACACTTTGAAATGG - Intergenic
1195674135 X:107494352-107494374 AATGCAAACCCACCTAGAAAAGG + Intergenic
1195946542 X:110219825-110219847 AATGAAAAATTACTTAGAGCTGG - Intronic
1196058663 X:111384281-111384303 AATGCATACGCACTTAGATTAGG - Intronic
1200259354 X:154604005-154604027 AATGCAAACAGACTAAGACAGGG - Intergenic
1200269079 X:154664292-154664314 AATGAAAACACAAAGAGAGCAGG - Intergenic
1200606864 Y:5274639-5274661 AATTAAAACACACTGACAGCTGG - Intronic