ID: 1041253405

View in Genome Browser
Species Human (GRCh38)
Location 8:55956969-55956991
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041253403_1041253405 21 Left 1041253403 8:55956925-55956947 CCCTGCTCTAAGTGTGTTTGCAT 0: 1
1: 0
2: 2
3: 18
4: 192
Right 1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG No data
1041253404_1041253405 20 Left 1041253404 8:55956926-55956948 CCTGCTCTAAGTGTGTTTGCATT 0: 1
1: 0
2: 3
3: 13
4: 188
Right 1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr