ID: 1041256198

View in Genome Browser
Species Human (GRCh38)
Location 8:55981374-55981396
Sequence AGATGCTCAAAAATGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041256197_1041256198 -10 Left 1041256197 8:55981361-55981383 CCTTGTATATAGTAGATGCTCAA No data
Right 1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG No data
1041256194_1041256198 10 Left 1041256194 8:55981341-55981363 CCCCAGCACTTGGTGCAGTGCCT No data
Right 1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG No data
1041256193_1041256198 19 Left 1041256193 8:55981332-55981354 CCTTTTTATCCCCAGCACTTGGT No data
Right 1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG No data
1041256196_1041256198 8 Left 1041256196 8:55981343-55981365 CCAGCACTTGGTGCAGTGCCTTG No data
Right 1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG No data
1041256195_1041256198 9 Left 1041256195 8:55981342-55981364 CCCAGCACTTGGTGCAGTGCCTT No data
Right 1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041256198 Original CRISPR AGATGCTCAAAAATGCTTGT TGG Intronic