ID: 1041256336

View in Genome Browser
Species Human (GRCh38)
Location 8:55982615-55982637
Sequence CACAGCAAGGAGGAGTGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041256336_1041256342 -8 Left 1041256336 8:55982615-55982637 CCCGAACACTCCTCCTTGCTGTG 0: 1
1: 0
2: 0
3: 17
4: 181
Right 1041256342 8:55982630-55982652 TTGCTGTGGTCAGCTCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041256336 Original CRISPR CACAGCAAGGAGGAGTGTTC GGG (reversed) Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
901337602 1:8464595-8464617 CACAGCAAGGAGGGGAGTGGTGG - Intronic
901663079 1:10811012-10811034 CACAGAAAGGAGGAGAAATCTGG + Intergenic
902849234 1:19140756-19140778 CACAGCAAGGAGCACGGCTCAGG - Intronic
902889339 1:19430588-19430610 CCCAGCAAGGAAGAGTATGCAGG + Intronic
904036441 1:27561507-27561529 CACAGCAAGGAGGGGTGCAGGGG + Intronic
907126327 1:52054451-52054473 CACAGCAAGGACAATTGTTGGGG + Intronic
911366476 1:96945203-96945225 CACAGGAATGAAGAGTGTTCAGG + Intergenic
911576496 1:99584624-99584646 AACAGGAAGGAGGAGAGTTAGGG + Intergenic
912129673 1:106586281-106586303 CACAGTAAGGAAGAGTATGCAGG - Intergenic
913067112 1:115266413-115266435 CACAGCGAGGAGCAGGGCTCAGG - Intergenic
913239795 1:116820064-116820086 CACAGCAAGGAGAGGTGTACTGG - Intergenic
915534108 1:156524263-156524285 CACAGCAGAGTGGAGTGTTGGGG + Intergenic
917843300 1:179000328-179000350 CACAGCAAGGGGGAATATCCTGG - Intergenic
920263634 1:204706447-204706469 GACAGCAGGGAGGAATGTTTTGG - Intergenic
920834921 1:209501983-209502005 CACCGGAAGGGGGAGTGCTCTGG + Intergenic
923147814 1:231210142-231210164 CATAGCAAGGAGGTGGCTTCAGG - Intronic
1063257094 10:4340398-4340420 CAGAGCAAGGACAAATGTTCTGG - Intergenic
1063496801 10:6516871-6516893 TACAGCAAGGAAGAGAGTTGGGG + Intronic
1064949984 10:20837402-20837424 CACAGAAATGAGGAGGGTTAGGG - Intronic
1069986293 10:72286480-72286502 CAGTGCTAGGAGGAATGTTCTGG + Intergenic
1070112893 10:73501651-73501673 CACAGTAAGGAGGAGTGGATGGG - Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1073458001 10:103649271-103649293 CACAGCATGGAGGGGTGATTAGG - Intronic
1073816321 10:107211794-107211816 CACAGCAAAAAGCAGTGTTAAGG - Intergenic
1075448649 10:122531511-122531533 CCCAGCCAGGAGGTGAGTTCTGG + Intergenic
1076238513 10:128884216-128884238 CCCAGCAAGGAGGTGTGACCAGG - Intergenic
1077718519 11:4604696-4604718 CACTGCTAGGAGGAGTTTGCAGG + Intronic
1079121695 11:17689804-17689826 CAGAGCAAGGAGGAGAGTAGAGG - Intergenic
1080324764 11:31057850-31057872 ATCACCAGGGAGGAGTGTTCAGG + Intronic
1081891019 11:46542597-46542619 CACAGAAGGGAGGGGTTTTCCGG - Exonic
1083337548 11:61933341-61933363 CACAAGATGGAGGAGTGTTGTGG + Intergenic
1083810986 11:65106909-65106931 GACAGCAAAGAGGAGGGTTGTGG + Intronic
1084855837 11:71985597-71985619 CACAGCAAGGAGGCATGGGCAGG + Intronic
1087882868 11:103439405-103439427 GATTGCAAGGAGGGGTGTTCAGG + Intronic
1089633803 11:119799583-119799605 CACAGGAAGGAAAGGTGTTCTGG - Intergenic
1090277418 11:125429809-125429831 CCCAGCAAGGAGGAGGGCCCTGG - Intronic
1091261190 11:134235535-134235557 CCCAGCCAGCAGGAGTGTGCTGG - Intronic
1094064595 12:26349869-26349891 CCCATGAAGGAGGAGAGTTCTGG + Intronic
1098651319 12:72973557-72973579 CACAGCAAGAAGGCTTTTTCTGG + Intergenic
1101282480 12:103272831-103272853 CACAGCAAGAAGGAATGATCGGG + Intronic
1102670782 12:114617088-114617110 AACAGCAAGGATGGGTGTTGAGG - Intergenic
1103986816 12:124772880-124772902 AACAGCAAGCAGGAGTGATGGGG + Intergenic
1104337383 12:127912213-127912235 CACAACAAGGAGAGGTCTTCTGG - Intergenic
1104759151 12:131286853-131286875 CACACCCAGGAGGTGGGTTCTGG + Intergenic
1104799981 12:131547871-131547893 CAAAGCCAGGAGGAGTGGACGGG - Intergenic
1104833823 12:131773862-131773884 CACAGCCAGGAGGAGAGTGGCGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1107430659 13:40337422-40337444 CACAGCAAGGAACAATGTTTTGG + Intergenic
1113879422 13:113615431-113615453 CACATCAGGGAGGAGAGTGCAGG - Intronic
1114025640 14:18523774-18523796 CAAAGCCAGCAGCAGTGTTCTGG - Intergenic
1114154262 14:20082551-20082573 CACAGGAAGGGGGACTGTTGTGG - Intergenic
1118281262 14:64430887-64430909 AACAGCGAGGAGGAGTGCACGGG - Intronic
1119540829 14:75437189-75437211 AAAAGCATGGAGGAGTTTTCTGG + Intronic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119995131 14:79245221-79245243 CACATCAAGGAAGGCTGTTCAGG - Intronic
1120740666 14:88105882-88105904 CCCACCCAGGAGGAGTGCTCAGG + Intergenic
1122329017 14:100900580-100900602 CACAGCAAAAAGGAGTGTAGGGG + Intergenic
1123900641 15:24873219-24873241 GACAGCAAGAGGGTGTGTTCAGG + Intronic
1125222179 15:37350998-37351020 CACAGCATGGAGGCATGTTGGGG + Intergenic
1127008270 15:54594770-54594792 CACAGTAGGGATGTGTGTTCGGG + Intronic
1127938676 15:63670471-63670493 CACAGGAAGGAGTAGTTCTCTGG + Intronic
1130738310 15:86572350-86572372 GACTGCAAGGAGGTGTGGTCTGG - Intronic
1130966092 15:88699125-88699147 CAGAGTAAAGTGGAGTGTTCTGG - Intergenic
1131366687 15:91847496-91847518 TACAGCAAGTAGGAGGGTTGAGG - Intergenic
1131444119 15:92481718-92481740 GATAGCAAGGAGAACTGTTCTGG + Intronic
1139034263 16:62924134-62924156 CACAGCCATGAGGAGTGTCAAGG - Intergenic
1141770372 16:86086068-86086090 CACAGCAAGGCGGAGGGAGCTGG + Intergenic
1143588949 17:7868436-7868458 TGCAGAAAGGAGGAGTGTTCTGG + Intronic
1144329354 17:14210367-14210389 CACAGCAAGGAGGTGGGGACAGG - Intergenic
1144819131 17:18059172-18059194 CACAGCGAGGAGGAGCTGTCTGG - Intronic
1147538458 17:41335719-41335741 CACAGCAGGGAGGGGTGGGCAGG + Intergenic
1151206497 17:72512052-72512074 CACAGCAAGGAGTGGCATTCTGG - Intergenic
1151219624 17:72602909-72602931 CACAGGGAGAAGGTGTGTTCTGG - Intergenic
1152940837 17:83172325-83172347 CACAGCCAGGTGGTGTGTTGGGG - Intergenic
1203159121 17_GL000205v2_random:32993-33015 CAAATCAAGCAGCAGTGTTCTGG + Intergenic
1154362928 18:13679541-13679563 AACCCCAAGGAGGACTGTTCTGG + Intronic
1158527346 18:58227067-58227089 CACAGCAAGGAGGACTGATGTGG - Intronic
1159507389 18:69354772-69354794 GAGAGTAAGGAGGAGTGTCCCGG - Intergenic
1160046237 18:75390023-75390045 CACAGGAAGGAGGAGTGCTGAGG + Intergenic
1161154858 19:2727307-2727329 GACAGCCAGGAGAAGAGTTCTGG + Intronic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1162097606 19:8320307-8320329 CACAGCAGGTAGTATTGTTCTGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165309555 19:35022072-35022094 CACAGCCAGGAGGCAGGTTCAGG - Intronic
1165807269 19:38588123-38588145 AAGGGCAAGGAAGAGTGTTCTGG + Intronic
1166142342 19:40811789-40811811 GACAGGAAGGATGAGTGCTCCGG - Intronic
1166185179 19:41135008-41135030 GACAGGAAGGATGAGTGCTCCGG + Intergenic
927010271 2:18896910-18896932 CACAGCAAGGAGCAGGGCTGAGG + Intergenic
927158647 2:20237306-20237328 CACAGCATGGAGGAAAGTTGAGG - Intergenic
929147926 2:38722653-38722675 CTCAGCAATGCTGAGTGTTCAGG - Intronic
929194536 2:39171792-39171814 CGGAGCACAGAGGAGTGTTCAGG + Intergenic
930641769 2:53860208-53860230 CAGAGCAAGGTGGAGTGGTAAGG + Intergenic
930764192 2:55067773-55067795 CACAGCACGGAAGAGTGTAAAGG - Intronic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
936820946 2:116520419-116520441 CAAAGCAAGGAAACGTGTTCAGG + Intergenic
940742302 2:157522853-157522875 ATCACCAAGGAGGAGTGTTTAGG + Intergenic
942419385 2:175792395-175792417 CAGACCAAGGACTAGTGTTCTGG - Intergenic
944161771 2:196669263-196669285 CACAGCATGGAGCAGGTTTCGGG - Intronic
945575580 2:211525068-211525090 CACTGCAAGCTGAAGTGTTCTGG + Intronic
946059864 2:216932765-216932787 CACAGCTAGGAGGAGGGGTCAGG - Intergenic
946776008 2:223142011-223142033 GCCAACAAGGAGGAGTGCTCGGG - Intronic
948674369 2:239588417-239588439 CATAGCAAAGAGGAGTGTACGGG - Intergenic
1168906302 20:1406555-1406577 GACAGCAAGGAGCATTTTTCAGG + Intergenic
1170932959 20:20785430-20785452 CACAGCAAGGTGCAGTGTGGGGG + Intergenic
1173132785 20:40410268-40410290 AAGAGCAAGGAGGGGTGTTGTGG + Intergenic
1173342532 20:42165331-42165353 TACAGCAGGGAGGTATGTTCAGG + Intronic
1173816371 20:45991661-45991683 CAAAGTATGGAGGAGTCTTCTGG - Intergenic
1175461573 20:59155625-59155647 CGCAGCAGGGAGGAGTGCTGGGG + Intergenic
1175772786 20:61634238-61634260 CACAGGAAGGAGGGGTATACAGG - Intronic
1179110867 21:38443996-38444018 CTCAGAGTGGAGGAGTGTTCTGG + Intronic
1179612435 21:42560925-42560947 CACCGCCAGGCTGAGTGTTCAGG + Intronic
1179630286 21:42673752-42673774 CACAGCGAGGAGGGCGGTTCTGG - Intronic
1180449824 22:15451399-15451421 CAAAGCCAGCAGCAGTGTTCTGG - Intergenic
1181462651 22:23094649-23094671 CAGAGCAAGGTGGAGGCTTCAGG - Intronic
1181934203 22:26427958-26427980 AACAGGAAGGAGGTATGTTCTGG + Intergenic
1181934269 22:26428188-26428210 AACAGGAAGGAGGTGAGTTCTGG + Intergenic
1182984839 22:34706578-34706600 CACAGTGAGGGGGAGTCTTCTGG + Intergenic
1184543639 22:45149537-45149559 CAAAGAAAGGAGTAATGTTCAGG - Intergenic
1184754907 22:46510296-46510318 CTCAGGAAGGGGGTGTGTTCTGG - Intronic
949171553 3:1004956-1004978 CACATCCAGGAGGAATGTTTGGG - Intergenic
950735750 3:15006710-15006732 CCCAGCAAAGAGAAATGTTCTGG - Intronic
952252834 3:31671347-31671369 CAGGGGAAGGAAGAGTGTTCTGG + Intronic
952549235 3:34457167-34457189 AGGAGCCAGGAGGAGTGTTCAGG + Intergenic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
956647239 3:71468358-71468380 CACACCAAGGAGAAATGTTGGGG - Intronic
957178733 3:76848663-76848685 CACAGCAAGGAGGTGACATCAGG - Intronic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
959871451 3:111332967-111332989 ACCAGCAAGGAGGAGAGCTCAGG + Intronic
960987563 3:123290667-123290689 CAAAGGAAGGAGGAGTCCTCAGG - Intronic
965730643 3:171768493-171768515 CACAGGAACAAGGAGTGATCTGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967532894 3:190569427-190569449 CATAGAAATGAAGAGTGTTCAGG - Intronic
969666516 4:8560457-8560479 CACAGCTAGGGGGAGGGTTGGGG + Intronic
974166579 4:58212481-58212503 CAAAGCAGGGAGGGGTTTTCAGG - Intergenic
975909200 4:79248123-79248145 CACTGCAAGCAGGTGTGGTCAGG - Intronic
978243650 4:106547215-106547237 CACAGCATGGAGGATTTTTAGGG + Intergenic
980425291 4:132619835-132619857 CACAGGAAGGCGAGGTGTTCTGG - Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
985229005 4:187794839-187794861 CACTGCACAGAGCAGTGTTCGGG + Intergenic
990020440 5:51119715-51119737 GACCACAAGGAGGATTGTTCAGG + Intergenic
995444264 5:112225089-112225111 CTTAGCAAGGAGGAATGTTTGGG - Intronic
996182068 5:120431818-120431840 CACTGCATAGAGGGGTGTTCTGG - Intergenic
998170578 5:139870056-139870078 CACAGGGAGGAGGAGGGTGCAGG + Intronic
1000925492 5:167188700-167188722 CACAGCCAGAAGGAGTCTTTAGG + Intergenic
1003868069 6:10381497-10381519 CCCAGATAGGAGGAGTGCTCAGG - Intergenic
1004105101 6:12660306-12660328 CACAGCAAAGGCGAATGTTCTGG - Intergenic
1006365672 6:33613811-33613833 CACAGCCAGGGAGAGTGTACAGG - Intergenic
1006983580 6:38163626-38163648 CACAGCCGGGAGGAGTGCGCAGG + Intergenic
1007243374 6:40442817-40442839 CACAACCAGGAGGGGTGTTCAGG - Intronic
1007432924 6:41786825-41786847 GGCAGCAGCGAGGAGTGTTCGGG - Exonic
1007975591 6:46098029-46098051 CTCAGCATGGAGGAGTGTGCAGG + Intergenic
1011339003 6:86291872-86291894 CTGAGCAAGGAGGTGTGTTGAGG + Intergenic
1017031063 6:150222577-150222599 CAGAGCACGGAGGATTGTTAGGG - Intronic
1017072368 6:150586862-150586884 CGCGGAAAGGAGAAGTGTTCTGG - Intergenic
1017432814 6:154387201-154387223 ACCAGCAAGGAGGAGTGAACGGG - Intronic
1018079140 6:160243787-160243809 CTGAGCAAAGAGGAGAGTTCAGG + Intronic
1019182069 6:170193663-170193685 CACAGCGGGGAGGTGTGTTTCGG - Intergenic
1020002059 7:4761794-4761816 CAAAGGAAGGAGGAGAGTTGGGG + Intronic
1020062853 7:5165529-5165551 CAGAGCACGGAGGATTTTTCGGG + Intergenic
1020165404 7:5803809-5803831 CAGAGCACGGAGGATTTTTCGGG - Intergenic
1022386416 7:29903469-29903491 CACAGCAATCTGGATTGTTCTGG + Intronic
1023526074 7:41104966-41104988 CACAGAAAGGATGAGAATTCAGG + Intergenic
1029415895 7:100443056-100443078 CACAGCAAGGAGGAGAATGTTGG + Intergenic
1031090536 7:117348546-117348568 CCCAGTAAGGAGGTGTGTTCTGG + Intergenic
1034396400 7:150828739-150828761 CGCAGCATGGATGAGTCTTCAGG - Intronic
1035067360 7:156116736-156116758 CACAGCAAAGGGGACTGTGCAGG + Intergenic
1035688864 8:1547008-1547030 CACAGCAAGGCCGAGTGGTGTGG + Intronic
1035772182 8:2156469-2156491 CCCAGCAAGAAGGTCTGTTCTGG - Intronic
1037142497 8:15536054-15536076 CACTGGAAGGAGAAGTGTTGTGG - Intronic
1037836122 8:22215768-22215790 CACAGCAAGGAGGGGGCTTCAGG + Intergenic
1038394689 8:27238166-27238188 GACAGCCAGGATTAGTGTTCTGG + Intronic
1039764029 8:40608857-40608879 CCCAGTAAGGATGTGTGTTCAGG + Intronic
1040339834 8:46434936-46434958 GACAGCAGGGTGGAGTGGTCGGG - Intergenic
1041256336 8:55982615-55982637 CACAGCAAGGAGGAGTGTTCGGG - Intronic
1045863272 8:106837018-106837040 CACAGCTGGGAGGAGGTTTCAGG + Intergenic
1047901980 8:129432401-129432423 CCCAGTAAGGATGTGTGTTCAGG + Intergenic
1048521795 8:135162560-135162582 AACACAAAGGAGGTGTGTTCAGG - Intergenic
1048820687 8:138377993-138378015 CACAGCAAGAAAGAGTGCTTAGG - Intronic
1051743037 9:20269509-20269531 GAGTGAAAGGAGGAGTGTTCTGG + Intergenic
1055552951 9:77447754-77447776 GAGAGCATGGAGCAGTGTTCAGG + Intronic
1055731952 9:79287516-79287538 CACAGCAATCAGAAGTGATCAGG - Intergenic
1056270821 9:84946571-84946593 GACAGCAATGAGGGGTGGTCAGG + Intronic
1057258428 9:93569225-93569247 CAGGGCAAGGAGGGGTGTCCTGG - Intergenic
1059439009 9:114292323-114292345 CAGAGCAAGGAGGTGGCTTCTGG - Intronic
1060790304 9:126481494-126481516 CACAGCACGCAGGGCTGTTCTGG + Intronic
1061205487 9:129160769-129160791 AACAGCAAGGAGGAGGCTACAGG + Intergenic
1061282371 9:129604712-129604734 CACAGCAAGTGTGGGTGTTCTGG - Intergenic
1062529261 9:136992726-136992748 CACTGCAAGGAGGGGTGTGGCGG - Intronic
1189090960 X:38082181-38082203 AACAGCAAGGAGGAGGCTTCAGG - Intronic
1189119500 X:38379098-38379120 CATAGCAAGTAGGACTGTTTGGG + Intronic
1189499751 X:41545417-41545439 CACAGCAATGAGGAATGGACAGG - Intronic
1193396527 X:80990409-80990431 CACTGCAAGCTGGAGTGCTCTGG + Intergenic
1194932761 X:99908092-99908114 AACAGGATGGAGGAGTGTTCTGG - Intergenic
1194995648 X:100588935-100588957 CAGAGCAATGAGGAGTGGTAGGG + Intronic
1198610895 X:138399222-138399244 CATAGCAAGGTGGAATGTTAGGG - Intergenic
1201850866 Y:18478447-18478469 CACATCATAGAGGAGTGCTCTGG - Intergenic
1201882453 Y:18841931-18841953 CACATCATAGAGGAGTGCTCTGG + Intergenic