ID: 1041257767

View in Genome Browser
Species Human (GRCh38)
Location 8:55994068-55994090
Sequence CCTGCTGTTTGAAATAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041257763_1041257767 29 Left 1041257763 8:55994016-55994038 CCATGAAAAGTTGACACTACATT No data
Right 1041257767 8:55994068-55994090 CCTGCTGTTTGAAATAGAGCTGG No data
1041257765_1041257767 -1 Left 1041257765 8:55994046-55994068 CCAAAGGAGTCTCTGATTTCTTC No data
Right 1041257767 8:55994068-55994090 CCTGCTGTTTGAAATAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041257767 Original CRISPR CCTGCTGTTTGAAATAGAGC TGG Intronic