ID: 1041258354

View in Genome Browser
Species Human (GRCh38)
Location 8:55998687-55998709
Sequence CTCCACATGATACTTTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041258354 Original CRISPR CTCCACATGATACTTTTGTT AGG Intronic
900832954 1:4978202-4978224 CTCCACATGATACGTTTAGAAGG + Intergenic
905900387 1:41577595-41577617 CACCCCATGATGTTTTTGTTTGG - Intronic
910360007 1:86406429-86406451 CTAAACATGATCCTTTTATTTGG + Intergenic
911327265 1:96482974-96482996 CTCATCATGATATTTTTGTGAGG - Intergenic
911449740 1:98047851-98047873 CTCCACTTTATACCTATGTTAGG - Intergenic
912985131 1:114420175-114420197 ATCCAAAGGATACTTTTCTTCGG + Intronic
915743849 1:158141178-158141200 CTCCAGATGTTACTTTTTCTAGG + Intergenic
915779132 1:158526324-158526346 CTCCAAACAATACTTTTCTTTGG - Intergenic
916570585 1:166022855-166022877 CTCCCCATGATGTCTTTGTTAGG + Intergenic
917208172 1:172600265-172600287 CTACAAATGACAATTTTGTTTGG - Intronic
922018430 1:221676605-221676627 CTCCAGATCATACTGATGTTGGG + Intergenic
923621623 1:235584028-235584050 CAAGACATGATGCTTTTGTTTGG + Intronic
1063212132 10:3890449-3890471 ATCCACATGGTGCTTTTTTTTGG + Intergenic
1067972413 10:50987847-50987869 CTGCACATGATAATTTCCTTTGG + Intergenic
1069182592 10:65380821-65380843 CACAAAATGATACTTTTTTTAGG + Intergenic
1070939556 10:80332002-80332024 CTCCACATTTTATTTTTGCTGGG - Intergenic
1071008818 10:80913728-80913750 GTCCACATCTTACTTTTTTTTGG - Intergenic
1072939539 10:99747879-99747901 CTCCAGATGATAATTTTATATGG - Intronic
1073871456 10:107869541-107869563 CTCCACAAGATACTTGTGATTGG - Intergenic
1073919833 10:108445972-108445994 CTCCATAACACACTTTTGTTTGG + Intergenic
1075561329 10:123470687-123470709 AACCACATGATACTTGTGATGGG + Intergenic
1078351232 11:10595379-10595401 TCCCACCTGACACTTTTGTTTGG + Intronic
1078542663 11:12224253-12224275 CTCCCCATTACACTTTTCTTTGG + Intronic
1080054192 11:27888306-27888328 CTCCAAACAATACTTTTCTTTGG + Intergenic
1080670175 11:34369159-34369181 CTCCACTTTATGTTTTTGTTTGG - Intergenic
1080949095 11:37008250-37008272 CTCCACATGTAACTCTTGCTCGG - Intergenic
1088360871 11:108988681-108988703 ATCAACATGATACTGGTGTTGGG + Intergenic
1090864632 11:130688403-130688425 ATCCACCTTATACTCTTGTTAGG - Intronic
1091597309 12:1886736-1886758 CTCCACGTCAACCTTTTGTTAGG - Intronic
1092072620 12:5644807-5644829 CACTACATGATATTTTTCTTGGG + Intronic
1094209653 12:27875483-27875505 CTCAACATGAGATTTTTGTTGGG + Intergenic
1094332040 12:29304267-29304289 TTCCACATGATAATCTTGATTGG - Intronic
1094456015 12:30633815-30633837 CTCCACATATTACTTTTGCAAGG + Intronic
1099051053 12:77782117-77782139 CTCCAGATGTGACTCTTGTTAGG - Intergenic
1099421733 12:82470211-82470233 CTCCAAATGTTACATTTCTTAGG + Intronic
1100056857 12:90522690-90522712 CTCCACATGAGACTACTTTTAGG - Intergenic
1100912434 12:99380811-99380833 CTCCACAACAAACATTTGTTAGG + Intronic
1101080386 12:101175788-101175810 CCCCAAAGGATATTTTTGTTGGG - Intronic
1101594117 12:106148581-106148603 CTCAAAATGATACTTTACTTGGG + Intergenic
1105987117 13:25578578-25578600 CTCCCCAGCATATTTTTGTTTGG + Intronic
1106892976 13:34266581-34266603 CCCCAGAGGGTACTTTTGTTTGG + Intergenic
1107536000 13:41333182-41333204 TTCCACAAGACACTTTTATTAGG - Intronic
1110856902 13:80306548-80306570 CTCCAAATGGCCCTTTTGTTAGG + Intergenic
1111386428 13:87534613-87534635 CTCCAGATGAGCCTTTTATTAGG + Intergenic
1113972008 13:114198507-114198529 CGCCACATGTTACTTTTGGAGGG + Intergenic
1114380742 14:22200744-22200766 CCCCACATTATGTTTTTGTTTGG + Intergenic
1114793740 14:25688275-25688297 CTGGACATGAAACTTTTGGTAGG + Intergenic
1119947372 14:78709184-78709206 ATTCACATGGCACTTTTGTTTGG + Intronic
1120062092 14:79995993-79996015 CTCCCCATCTTTCTTTTGTTAGG - Intergenic
1121174279 14:91879131-91879153 CTGCACATGATACTTTATTGTGG - Intronic
1122486084 14:102081183-102081205 CTCCAAACAATACTTTTCTTTGG + Exonic
1125230458 15:37449366-37449388 CTCTAAAAGATACTTTTATTAGG + Intergenic
1134800852 16:17083233-17083255 CTCCACAAGCTACCTTTGGTTGG - Intergenic
1134914891 16:18061173-18061195 CTCCAAATGTTAGTTTTGATGGG - Intergenic
1136013155 16:27377785-27377807 CTCAACAGGATGCTTTTGCTGGG + Intergenic
1139158865 16:64478650-64478672 CTCCACCGGAAACTTATGTTTGG + Intergenic
1149125007 17:53218488-53218510 TTCCACATGATATTTTGGTGAGG + Intergenic
1151469251 17:74307795-74307817 CTCCAGATGTTTCTTTTTTTGGG + Intronic
1155302794 18:24447323-24447345 TTCCACATGATACCATTGGTAGG + Intronic
1157379116 18:47195002-47195024 CTTCACATGATACTATTGTGCGG + Intergenic
1163460609 19:17435352-17435374 CTCCACCAGTTAGTTTTGTTTGG - Intergenic
928952933 2:36830713-36830735 TTCCACAGGATATTTTTATTGGG + Intergenic
930559412 2:52941984-52942006 CTCCAGGGGATACTTATGTTGGG - Intergenic
930637659 2:53823681-53823703 CTCCACATCATAATTCTGATTGG - Intergenic
933484680 2:82904336-82904358 GTCCACATGGAACTCTTGTTGGG + Intergenic
934982585 2:98856900-98856922 CTTCTCATGATTCTTTTATTAGG + Intronic
938049672 2:128157246-128157268 CTACAGATGATTCTTTTATTAGG + Exonic
940567063 2:155378694-155378716 TTACACATGATAATTTTATTTGG + Intergenic
942209101 2:173652666-173652688 CTCCAGAGGATACATTTGCTGGG - Intergenic
942246198 2:174011429-174011451 CTCTACATGATACATTTTTATGG + Intergenic
942902842 2:181144119-181144141 ATGCACATGATACTATTATTTGG - Intergenic
943854606 2:192773197-192773219 CGCCACTAGATGCTTTTGTTTGG + Intergenic
943862530 2:192886969-192886991 CTCCTCATTACAGTTTTGTTTGG + Intergenic
945154929 2:206828482-206828504 CTCAACATGACACTTCTGTCTGG + Intergenic
948087038 2:235259407-235259429 GCCCACATGTTTCTTTTGTTTGG + Intergenic
948166861 2:235869693-235869715 CTCCACAAGATACTTTCTTAGGG + Intronic
1169851333 20:10054891-10054913 CTCCTAAGGATACTTTTTTTTGG + Intronic
1179199822 21:39206102-39206124 GTTTACCTGATACTTTTGTTAGG + Exonic
1181871707 22:25904380-25904402 CTCCACATGAACCTTATGTAGGG + Intronic
1182638063 22:31744871-31744893 CACCTCTTGATACTCTTGTTTGG + Intronic
1182682613 22:32093066-32093088 CCCCACTTTATATTTTTGTTTGG + Intronic
949104229 3:183926-183948 CTCCACAGGACACCTCTGTTAGG + Intergenic
953989216 3:47470963-47470985 ATCCTCATTATACTTTTTTTTGG - Intronic
956657471 3:71566485-71566507 CTGGAAATGATACTTTAGTTGGG - Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957840502 3:85662601-85662623 CTGCAAATGATACTTTTGTCAGG + Intronic
961916037 3:130376106-130376128 CTCCAGAAGACACTTTTCTTGGG + Intronic
964942453 3:162175937-162175959 GGCAACATGATACCTTTGTTTGG - Intergenic
967235072 3:187376330-187376352 CTCTTCAACATACTTTTGTTTGG + Intergenic
968972769 4:3804517-3804539 TTCCACATGAGGCTTTTGTGGGG - Intergenic
970341425 4:15111346-15111368 TTCCACATGCTGCTGTTGTTGGG + Intergenic
971921683 4:32948525-32948547 CTCCACTTTATGTTTTTGTTTGG - Intergenic
973060326 4:45716214-45716236 TTCCAGTTGATAGTTTTGTTTGG - Intergenic
973165687 4:47075222-47075244 GTCCATGTGCTACTTTTGTTGGG - Intronic
973181525 4:47274726-47274748 CTCCACTGGTTACTTTTGATGGG + Intronic
974223648 4:59009741-59009763 CTCCCAAGGCTACTTTTGTTTGG - Intergenic
977069127 4:92360829-92360851 CTCCACAGGAAACTTTTGTGGGG + Intronic
977402727 4:96554407-96554429 CTCCATCTGATAGTTTAGTTTGG + Intergenic
983522742 4:168727598-168727620 CTGGACATGAGACCTTTGTTTGG + Intronic
983696795 4:170542182-170542204 CTCTACATGTTATTTTTGTTGGG + Intergenic
983701788 4:170605602-170605624 CTCCAAATAATACTTTTCTTTGG - Intergenic
985389046 4:189475696-189475718 CTCCAAACAATACTTTTCTTTGG - Intergenic
986547251 5:8911891-8911913 CACCACTTGATGTTTTTGTTAGG - Intergenic
986935675 5:12883057-12883079 CTTCCCATGATGCTTTTCTTGGG - Intergenic
988344992 5:30025577-30025599 CTCCACTTTATGTTTTTGTTTGG - Intergenic
988736943 5:34032082-34032104 ATCCACAAGTTACTTTTTTTGGG + Intronic
990982335 5:61613453-61613475 CTCCAAATAATATTTTTCTTAGG + Intergenic
992700237 5:79334438-79334460 CTCCACATGTTGTTTGTGTTGGG + Intergenic
994151970 5:96457787-96457809 CCCCACACCATCCTTTTGTTAGG - Intergenic
994417285 5:99488145-99488167 CTTCACTTGACAATTTTGTTGGG + Intergenic
994462676 5:100087006-100087028 CTTCACTTGACAATTTTGTTGGG - Intergenic
994864247 5:105245390-105245412 CTCCCCATCATACTCTGGTTAGG + Intergenic
994950516 5:106455361-106455383 CTCCAAATGAGACCTATGTTAGG - Intergenic
995002218 5:107147852-107147874 CTACACATGTTACTTTTGTTTGG + Intergenic
995908223 5:117152823-117152845 TTCCAAATGAAACTTTTGCTTGG - Intergenic
996352333 5:122558638-122558660 CTCCACAACATACTCTTATTGGG - Intergenic
997149492 5:131477608-131477630 CTCCACATTATCCTTTGGTGAGG - Intronic
997610617 5:135213250-135213272 CTCCACATGTGGCTATTGTTAGG - Intronic
999041481 5:148418030-148418052 CTACAGATGATTCTTTTGTCAGG - Intronic
1000734357 5:164880809-164880831 CTCCACATGAAAACTTTATTTGG + Intergenic
1004255880 6:14063951-14063973 CTCCATCGGAAACTTTTGTTTGG - Intergenic
1005304625 6:24501401-24501423 CTCCAAACTATACTTTTCTTTGG - Intronic
1005528599 6:26678400-26678422 CCCCACCTGATAATTATGTTTGG - Intergenic
1005542197 6:26823248-26823270 CCCCACCTGATAATTATGTTTGG + Intergenic
1012237862 6:96838302-96838324 CTCAAGATGATACTTTTTCTGGG - Intergenic
1013411388 6:109887170-109887192 CTCCTCATGCTACATTTGTGAGG - Intergenic
1015837207 6:137433391-137433413 CTTCACATGTTGCTTTTATTCGG - Intergenic
1019838184 7:3411939-3411961 CTCTACATGCTAATTCTGTTTGG - Intronic
1019862024 7:3668066-3668088 CCTCAAATGATAGTTTTGTTAGG - Intronic
1020773223 7:12421924-12421946 CTCAACATGACAATTTTGTTTGG - Intergenic
1026175551 7:67993650-67993672 CTGCATCTGATTCTTTTGTTAGG + Intergenic
1027608695 7:80332309-80332331 CTACTCATGGTAATTTTGTTGGG - Intergenic
1028790931 7:94851865-94851887 CTCCAAATAATGCTTGTGTTGGG - Intergenic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1031772853 7:125867264-125867286 CTCCACTTATTACTTTTTTTAGG - Intergenic
1031976871 7:128099587-128099609 TTCTAAATGATACTTCTGTTTGG + Intergenic
1035899576 8:3444644-3444666 TTCCACTGCATACTTTTGTTTGG - Intronic
1038988849 8:32843997-32844019 ATCCTCATGATAATTTTGTGAGG - Intergenic
1039318664 8:36402787-36402809 CTCCACATTATATATTTCTTAGG - Intergenic
1040494472 8:47954176-47954198 CTTCACATGTTGTTTTTGTTTGG + Intronic
1041258354 8:55998687-55998709 CTCCACATGATACTTTTGTTAGG + Intronic
1043077140 8:75716155-75716177 CTCCACTCAATACTTTTGTGTGG + Intergenic
1043698773 8:83256605-83256627 CTCAAGATGAAACTTTTCTTTGG - Intergenic
1044727432 8:95204830-95204852 CAACAAGTGATACTTTTGTTAGG + Intergenic
1044801217 8:95958376-95958398 TTCCAAATGATTCCTTTGTTTGG - Intergenic
1045484557 8:102621115-102621137 TCCCACATGATTTTTTTGTTTGG - Intergenic
1045881341 8:107044465-107044487 CTCCACTTTATGTTTTTGTTTGG - Intergenic
1046250781 8:111628166-111628188 CTCCACTTTATGTTTTTGTTTGG + Intergenic
1046281448 8:112038097-112038119 CACCAAAATATACTTTTGTTTGG + Intergenic
1046642640 8:116749782-116749804 CTCCAAATGATACTTTTCTTTGG + Intronic
1048477803 8:134758845-134758867 CACCACATCATGCTTTTATTTGG - Intergenic
1051151912 9:14089421-14089443 CTCCATATGATACTTTTTAAAGG - Intronic
1052079426 9:24185922-24185944 CACCACAAGGTACTTTTCTTTGG + Intergenic
1057089468 9:92244129-92244151 CATCACATGACACTTTTGTAAGG + Intronic
1058210559 9:102163006-102163028 CTCCACATGGTACATATGATTGG + Intergenic
1059753847 9:117274047-117274069 CTCCACTCCAGACTTTTGTTGGG - Intronic
1188397857 X:29706674-29706696 CCCCACTTGATATTTTTGTTGGG - Intronic
1196386069 X:115152769-115152791 TTCTTCATGTTACTTTTGTTTGG - Intronic
1199104005 X:143840392-143840414 CTATACATGATGCTCTTGTTAGG + Intergenic
1200024352 X:153243488-153243510 ATCCAAATGAAGCTTTTGTTTGG + Intergenic