ID: 1041258421

View in Genome Browser
Species Human (GRCh38)
Location 8:55999447-55999469
Sequence CATCCAAAGTTGATTGCTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041258421_1041258423 10 Left 1041258421 8:55999447-55999469 CCAGAAGCAATCAACTTTGGATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1041258423 8:55999480-55999502 AAGTCTGATGTGTGGTCCTTTGG 0: 1
1: 0
2: 8
3: 18
4: 138
1041258421_1041258422 2 Left 1041258421 8:55999447-55999469 CCAGAAGCAATCAACTTTGGATG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1041258422 8:55999472-55999494 TCACTATTAAGTCTGATGTGTGG 0: 1
1: 0
2: 0
3: 28
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041258421 Original CRISPR CATCCAAAGTTGATTGCTTC TGG (reversed) Exonic
902529332 1:17080482-17080504 CATTCCATGTTGATTGCTGCTGG - Intronic
905312582 1:37060345-37060367 CATACAAAGTTGTTGGCATCTGG + Intergenic
906722301 1:48017805-48017827 CTTCCTAAGTTGATTGAATCAGG + Intergenic
906913358 1:49981073-49981095 GAAACAAAGTTGAATGCTTCTGG + Intronic
907793763 1:57693751-57693773 CATCCAGAGTTTCTTCCTTCTGG - Intronic
909244049 1:73254552-73254574 CATCCAGAGTTTCTTCCTTCTGG - Intergenic
912437158 1:109669642-109669664 TGTCCAAAATTGATTCCTTCTGG + Intronic
918297324 1:183169317-183169339 CATCCAACCTTAATTGCTACTGG + Intergenic
918748412 1:188238067-188238089 GAAACAAAGTTGATTGGTTCTGG + Intergenic
920084536 1:203405647-203405669 CCTCCAAAGTTGATTTCAGCGGG + Intergenic
924665032 1:246063021-246063043 CATCCACAGCTGACTGCATCAGG + Intronic
1065600984 10:27368451-27368473 CATCCAAACATTATTGCTTTTGG + Intergenic
1071429310 10:85593948-85593970 CATACACAGCTCATTGCTTCAGG + Intergenic
1071834535 10:89406681-89406703 CATCCAGAGTTTCTTCCTTCTGG - Intronic
1074836324 10:117299272-117299294 AATCCACAGTTGATTGAATCTGG + Intronic
1075282698 10:121154113-121154135 AATCCAAAGTTGTTAGCATCAGG + Intergenic
1076077827 10:127550779-127550801 CATGCCAATTTGATTGCTTAGGG + Intronic
1079998350 11:27320173-27320195 CATCCAATGTTGGTTCCTTGGGG + Intergenic
1080318862 11:30982829-30982851 CATACTGAGATGATTGCTTCTGG + Intronic
1081295113 11:41376923-41376945 CATTGAAAGTTAATTGCTTTAGG - Intronic
1081520159 11:43873669-43873691 CATCTTAACTTGATTGCATCTGG + Intergenic
1087084711 11:94204612-94204634 CATACAAAGTTGAGCGTTTCAGG + Intergenic
1089173137 11:116529267-116529289 CATCCAAAGTTTGGTGCTTTTGG - Intergenic
1090649693 11:128795441-128795463 CAACCAAAGCTAATTTCTTCTGG - Intronic
1090910786 11:131117622-131117644 AATGCAAAATTGATCGCTTCAGG + Intergenic
1092696778 12:11180281-11180303 TATCCAAAGTTGACTGATTGTGG + Intergenic
1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG + Intronic
1095622098 12:44269145-44269167 CATTCAAACTGGATTGCTTTTGG + Intronic
1097395800 12:59073222-59073244 AATCCAGAGATGGTTGCTTCAGG - Intergenic
1097952098 12:65442694-65442716 CATCTAAAGTTGAATGTTTTTGG + Intronic
1100569479 12:95833767-95833789 CATTCAAAATTAATTGCTTTAGG - Intergenic
1101286795 12:103322282-103322304 CATCCACAGTTGATTGGTCAAGG + Intronic
1101436132 12:104666300-104666322 CATCCAAAGTTGAATTGTTTTGG - Intronic
1103760720 12:123248542-123248564 CATCCAGAGTTTCTTCCTTCTGG + Intronic
1105741517 13:23328905-23328927 CCTCCACATTTTATTGCTTCTGG - Exonic
1107332803 13:39319782-39319804 GTTCCAAAGTTGTTTGCCTCAGG - Intergenic
1108067392 13:46592288-46592310 CATCCCAAGTTAACTGCTTATGG + Intronic
1108990255 13:56647116-56647138 CATCTAAAGGTCATTGATTCTGG + Intergenic
1110716595 13:78711788-78711810 CATTCATAGTTGATTACTTGTGG - Intergenic
1112146944 13:96710411-96710433 CATCCAGAGCTGACTGCTTCAGG + Intronic
1112339719 13:98543125-98543147 CCTCCAAAGTTTACAGCTTCGGG + Intronic
1113506539 13:110820902-110820924 CATCCATAGTGGACTGGTTCAGG + Intergenic
1120694670 14:87631435-87631457 CATTCAAAGTTGAATGCCACTGG - Intergenic
1121631729 14:95426194-95426216 CATCAAAGACTGATTGCTTCTGG + Intronic
1125424498 15:39535515-39535537 CATCCAAAGGCGATAGCTTTGGG - Intergenic
1129962122 15:79696975-79696997 CCTCCATAGTTGTTTACTTCAGG + Intergenic
1137527213 16:49246772-49246794 CATGCAATGTAGATTGCTTTAGG - Intergenic
1140235273 16:73153207-73153229 CATCCAAAGTTGAGAGCTCTGGG - Intergenic
1140462663 16:75153227-75153249 CTTTCAAAGTTGGTTGTTTCTGG - Intronic
1142738974 17:1919387-1919409 CCTCCAGAGCTAATTGCTTCAGG - Intergenic
1144727564 17:17509532-17509554 CATCCACAGGTGATTACTTCGGG - Exonic
1145868862 17:28257457-28257479 GATCCAAAGTTCATCGATTCTGG + Intergenic
1153331810 18:3881467-3881489 CCTACAGAGTTGCTTGCTTCAGG + Intronic
1154059956 18:11050336-11050358 CATTTAAAGCTGATTGCATCTGG - Intronic
1160877053 19:1301371-1301393 AATCCAAAGTTGATTGTGACGGG - Intergenic
1164423667 19:28120252-28120274 CTTCCAAAGTGGATTGTTTTTGG - Intergenic
928655275 2:33444479-33444501 CATTTCAAGTTGATAGCTTCAGG + Intronic
930568921 2:53060150-53060172 CACCCTCAGTTGTTTGCTTCTGG - Intergenic
931648503 2:64447728-64447750 CATCCAAATTTGATTGCCCAAGG - Intergenic
932465409 2:71920416-71920438 CATCCCTAGAAGATTGCTTCAGG - Intergenic
932982132 2:76681797-76681819 TGTCCAAAGTTGCTTGCTACTGG - Intergenic
935158841 2:100511387-100511409 CATCCAAAGTTGAGACCTACTGG + Intergenic
936894995 2:117417370-117417392 CATCGAATGCTCATTGCTTCTGG - Intergenic
941010104 2:160289734-160289756 CATCAAAAGTATTTTGCTTCTGG - Intronic
941084037 2:161095628-161095650 CATTCAGAATTGATTTCTTCAGG - Intergenic
941313481 2:163963791-163963813 CATCCAGAATTTATTCCTTCTGG + Intergenic
941380977 2:164792066-164792088 CAGCCAATGGGGATTGCTTCGGG - Intronic
942486401 2:176444171-176444193 CATGCAAAGTTGCATACTTCTGG + Intergenic
942823391 2:180143544-180143566 AATCCAATGTTGATTGCTCTGGG - Intergenic
944063274 2:195591908-195591930 CTTCCAAAGTTAATTGGTTGTGG + Intronic
948086982 2:235258798-235258820 CATCCAGAGCTGATTGGATCAGG + Intergenic
948884187 2:240874773-240874795 CACCCAAAGGTGACTGCTTTCGG - Intronic
1170467464 20:16635840-16635862 CTGCCAAAGTTGGTTCCTTCTGG - Intergenic
1172048565 20:32099033-32099055 GAGCCAAAGTTGATGGCTTCAGG - Exonic
1174425045 20:50426282-50426304 CTTTGAAAGTTGATGGCTTCAGG + Intergenic
1175497226 20:59423481-59423503 CATCCTAGGTTGAGTGCTACAGG - Intergenic
1178982240 21:37274251-37274273 CATCCCAAGTAGAATGCTTTTGG + Intergenic
949723291 3:7015317-7015339 CATCCACAGTTGGTTCCTTCTGG - Intronic
950732173 3:14970153-14970175 CCTCTAAATTTGATTTCTTCTGG + Intronic
951674044 3:25216982-25217004 CATCCAGATTTGATTGTTTAAGG + Intronic
956389884 3:68760180-68760202 CAACAAAAATTGATTGCTTCAGG + Intronic
957135126 3:76277604-76277626 CATCCAAAGTCAATTGCTGAAGG - Intronic
961836282 3:129663192-129663214 CACCCAAAGAGGAATGCTTCAGG - Intronic
962191765 3:133318526-133318548 CATGCAAAGTTCATAGATTCTGG - Intronic
964864093 3:161234953-161234975 TTTCCAAAGGTGAATGCTTCAGG - Intronic
971112086 4:23598389-23598411 CATCAAATATTGATTGTTTCTGG - Intergenic
971908468 4:32760796-32760818 AATCCAAAGATGTTGGCTTCAGG + Intergenic
972295172 4:37730727-37730749 CATCCAAAGTTACTTGTGTCAGG - Intergenic
972397211 4:38667685-38667707 GATCCAAAATTGACAGCTTCAGG - Intronic
973640047 4:52893626-52893648 CAGCCACAGTTGATTGGTCCTGG + Intronic
976462778 4:85332050-85332072 TATCCAAAGTCTTTTGCTTCAGG - Intergenic
976715218 4:88116317-88116339 CATCCAAAGCTGAATGGTTCAGG - Intronic
980088767 4:128419398-128419420 CAGCCAAACTTAATTTCTTCTGG + Intergenic
986931818 5:12834374-12834396 TCCCCAAAGTTGATTCCTTCAGG + Intergenic
988100007 5:26663025-26663047 CTTCCAAGGGCGATTGCTTCTGG - Intergenic
988897565 5:35694098-35694120 CATCCAATATTGTTTGTTTCTGG + Intronic
994851723 5:105063387-105063409 CATGCATGGTTGATTCCTTCTGG - Intergenic
995452034 5:112312872-112312894 TATTCAAAGATGATTTCTTCTGG - Intronic
996450370 5:123615339-123615361 CATCCAAAGTTTTCTGCTTAAGG - Exonic
1000265866 5:159635706-159635728 CAAGCAAAGTTGATTCCTTTGGG - Intergenic
1000933107 5:167276591-167276613 CATCCACAGGGGATTGGTTCCGG + Intergenic
1001053511 5:168431148-168431170 CATCCACTGTTGTTTGCTTAGGG + Intronic
1001653815 5:173333117-173333139 CTTCCAAAGTTGGTTGTTTGGGG - Intergenic
1002163272 5:177329667-177329689 CTGCCAAAGGTGATTGCTGCAGG - Intergenic
1007919931 6:45597794-45597816 CATCCAAAATTTATTCCTTGGGG - Intronic
1008214565 6:48771997-48772019 CAACGAAAATTAATTGCTTCTGG - Intergenic
1008557435 6:52687663-52687685 CATCCAAATATGAATCCTTCTGG - Intergenic
1013365366 6:109433615-109433637 CACCCTAAGTGGATGGCTTCAGG - Intronic
1013536383 6:111066692-111066714 ACTCCAAAGTTGGTTGCTCCTGG + Intergenic
1016084277 6:139893910-139893932 AATCTAAAGTGGATTCCTTCTGG - Intergenic
1016226501 6:141745798-141745820 GATACAAAATTGATTGCTTTTGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1023778808 7:43636508-43636530 CTTCCAAAGCTGCTTGCTTTGGG + Intronic
1024296488 7:47847227-47847249 AATCCAAATTTAAATGCTTCGGG - Intronic
1028901877 7:96110423-96110445 CATTTAAAGTTGGTTGCTTTAGG + Intergenic
1041258421 8:55999447-55999469 CATCCAAAGTTGATTGCTTCTGG - Exonic
1041695652 8:60733350-60733372 CATACAATGTTGAGTACTTCAGG + Intronic
1051402168 9:16694843-16694865 CATACAAAGTTGATTTCTAAGGG + Intronic
1053624890 9:39859543-39859565 TGTCCAGAGTTGATTCCTTCTGG + Intergenic
1053879979 9:42583685-42583707 TGTCCAGAGTTGATTCCTTCTGG - Intergenic
1054219006 9:62391155-62391177 TGTCCAGAGTTGATTCCTTCTGG - Intergenic
1054231710 9:62518014-62518036 TGTCCAGAGTTGATTCCTTCTGG + Intergenic
1055075449 9:72210374-72210396 TATCCAAATTTTATTGCATCTGG - Intronic
1056694543 9:88835244-88835266 CCTCCAAACTTCATTGTTTCAGG - Intergenic
1058794884 9:108488455-108488477 CCACCAGAGTTGATTCCTTCTGG + Intergenic
1188850215 X:35123051-35123073 CAGCCAAGGTTGATTGCTACTGG - Intergenic
1195684849 X:107576339-107576361 CAGGCAAAGTTGGTGGCTTCAGG - Exonic
1200554803 Y:4623737-4623759 CATTCATTATTGATTGCTTCAGG - Intergenic
1201910814 Y:19132048-19132070 TATCCAGAGTTGGTTGCTTCTGG - Intergenic
1201913332 Y:19156045-19156067 TGTCCAAAGTTGGTTCCTTCTGG - Intergenic