ID: 1041271165

View in Genome Browser
Species Human (GRCh38)
Location 8:56110909-56110931
Sequence TCCAGGGCCCCTAATTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041271155_1041271165 30 Left 1041271155 8:56110856-56110878 CCTGTTCTCTGATTTCTTCCCCA No data
Right 1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG No data
1041271158_1041271165 10 Left 1041271158 8:56110876-56110898 CCAACATTTGCACTTCCTAGTGG No data
Right 1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG No data
1041271161_1041271165 -5 Left 1041271161 8:56110891-56110913 CCTAGTGGGCTCCTGTTCTCCAG No data
Right 1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG No data
1041271157_1041271165 11 Left 1041271157 8:56110875-56110897 CCCAACATTTGCACTTCCTAGTG No data
Right 1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG No data
1041271156_1041271165 12 Left 1041271156 8:56110874-56110896 CCCCAACATTTGCACTTCCTAGT No data
Right 1041271165 8:56110909-56110931 TCCAGGGCCCCTAATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041271165 Original CRISPR TCCAGGGCCCCTAATTTTGC AGG Intergenic
No off target data available for this crispr