ID: 1041271416

View in Genome Browser
Species Human (GRCh38)
Location 8:56113067-56113089
Sequence CCTCGAAGACGGCAGCGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1041271409_1041271416 3 Left 1041271409 8:56113041-56113063 CCCAAGGCGCTGCCCGGGGAGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1041271412_1041271416 -10 Left 1041271412 8:56113054-56113076 CCGGGGAGCGAGTCCTCGAAGAC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1041271410_1041271416 2 Left 1041271410 8:56113042-56113064 CCAAGGCGCTGCCCGGGGAGCGA 0: 1
1: 0
2: 1
3: 12
4: 96
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1041271411_1041271416 -9 Left 1041271411 8:56113053-56113075 CCCGGGGAGCGAGTCCTCGAAGA 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1041271408_1041271416 4 Left 1041271408 8:56113040-56113062 CCCCAAGGCGCTGCCCGGGGAGC 0: 1
1: 0
2: 0
3: 18
4: 154
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58
1041271403_1041271416 24 Left 1041271403 8:56113020-56113042 CCAGCAGCGCTGGATGACGTCCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1041271416 Original CRISPR CCTCGAAGACGGCAGCGGAG AGG Exonic
901783034 1:11607132-11607154 CCACGAAGACAGCAGCTTAGTGG + Intergenic
904822610 1:33255840-33255862 CCTCGAAGACGGCCGCCTGGAGG - Intergenic
905553222 1:38860013-38860035 CCCGGAAGAAGGCAGGGGAGCGG - Intronic
913126378 1:115794065-115794087 CCTGGAAGACACCAGGGGAGGGG + Intergenic
915172967 1:153990952-153990974 CCGCATAGACGGGAGCGGAGAGG + Intronic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
922703350 1:227775116-227775138 CCTCCAGGAATGCAGCGGAGGGG + Intronic
1076529987 10:131137543-131137565 CCTGGAAGAAGGCATGGGAGTGG + Intronic
1083694870 11:64436143-64436165 CCAGGAAGCGGGCAGCGGAGGGG + Intergenic
1083936170 11:65871256-65871278 CGTTGATGACGGCAGCGGAGCGG + Exonic
1087509270 11:99069424-99069446 CCTCGAAGTTGCCAGTGGAGAGG + Intronic
1088299387 11:108339856-108339878 ACTCAAAGACAGCAGGGGAGAGG + Intronic
1091356434 11:134941291-134941313 CCTCCAGGACAGCAGCAGAGAGG - Intergenic
1118313305 14:64708382-64708404 CCTGGAGGTCGGAAGCGGAGTGG + Intronic
1127395722 15:58542512-58542534 CCTGGAAGACAGCAGCGGGATGG - Exonic
1128547888 15:68579683-68579705 CCCCGAGGAGGCCAGCGGAGGGG + Intronic
1129341674 15:74890368-74890390 CATCGAGGCCTGCAGCGGAGGGG + Intronic
1132500039 16:281063-281085 CCGAGAAGACGGGAGCGAAGTGG + Intronic
1134163908 16:11915381-11915403 CCACGGAGCCGGCAGCGGCGCGG - Exonic
1134656208 16:15949895-15949917 CCCCGAGGCCGGCAGCAGAGCGG - Intronic
1137044501 16:35642994-35643016 CCTGGAAGATGGCATGGGAGTGG + Intergenic
1137501235 16:49013225-49013247 CCTGGCAGATGGCAGCAGAGTGG - Intergenic
1138276234 16:55736910-55736932 CCTCCAGGAAGGCAGCAGAGAGG - Intergenic
1138506005 16:57478619-57478641 CCTAGAAGACAGGAGCAGAGGGG - Intronic
1203145208 16_KI270728v1_random:1794462-1794484 CCTCGTGGACGGCAGCGCTGTGG - Intergenic
1144749714 17:17640031-17640053 CCTGGAAGACGGCAGTGATGTGG + Intergenic
1148075774 17:44934506-44934528 CCTGGAAGATGGCATGGGAGCGG + Exonic
1151185579 17:72361680-72361702 CCTCGAAGACACCAGTGCAGTGG - Intergenic
1154218213 18:12431343-12431365 CCACGCAGACGGCGGCGGTGGGG - Exonic
1154498215 18:14978014-14978036 CCTCCAGGACAGCAGCAGAGAGG + Intergenic
1155932693 18:31724023-31724045 CCTCGCAGAGGGGAGGGGAGGGG + Intergenic
1163109651 19:15151859-15151881 CCTCCAAGATGAGAGCGGAGAGG - Intergenic
1163491183 19:17618011-17618033 CCTGGAAGACGGCATGTGAGAGG - Intronic
926222370 2:10944669-10944691 CCTGGAGGACAGCAGGGGAGAGG - Intergenic
932331504 2:70900693-70900715 CTGCGGAGACCGCAGCGGAGCGG + Exonic
935239763 2:101168326-101168348 CCTCGAGTAGGGCAGAGGAGAGG + Intronic
1169345010 20:4822829-4822851 CCTAGAAGACGGCGGCGGACTGG + Intronic
1169382442 20:5119789-5119811 CCTCGAACATGGTGGCGGAGTGG + Exonic
1175396572 20:58668067-58668089 CCTGGATGACAGCAGCGAAGAGG + Exonic
1183692682 22:39399795-39399817 CCTCCAAGATGGCGGCGCAGAGG + Exonic
1185321075 22:50200539-50200561 CCTCCTAGACGGCAGGCGAGGGG + Intergenic
953598492 3:44339665-44339687 CCTGGAAGAGGGCAGAGGACCGG - Intronic
967272093 3:187740456-187740478 CCTCCAAGACTGCTGGGGAGCGG + Intronic
969909645 4:10431763-10431785 CCTCGAAGATGACATTGGAGAGG + Intergenic
972290473 4:37686233-37686255 CCACGAAGACAGCAGCGGCTAGG + Exonic
985754840 5:1707475-1707497 CCTAGCAGACGGCAAGGGAGGGG + Intergenic
1002898852 6:1394084-1394106 CCACGAAGATGCCTGCGGAGGGG + Intronic
1004544677 6:16586526-16586548 CCTCACAGACTGCAGTGGAGTGG - Intronic
1004720428 6:18264162-18264184 CCTGGACGGCGGCGGCGGAGCGG - Intronic
1006470014 6:34223480-34223502 CCACGAAGTCGGCATGGGAGGGG + Intergenic
1010665425 6:78624203-78624225 CCTCAAAGATGGCAGAGGACAGG + Intergenic
1014947263 6:127514324-127514346 CCTGGAAGAAGGAAGTGGAGTGG + Intronic
1020478850 7:8632643-8632665 CCTCAAAGATGGCAGCTGTGTGG + Intronic
1025729942 7:64100249-64100271 CCCCGCAGACGGCTGCCGAGCGG + Intronic
1034784860 7:153916416-153916438 CTTCGAAGAGGGGAGGGGAGGGG - Intronic
1037348297 8:17923089-17923111 CCTCGGAGACCGCAGCAGAGAGG - Exonic
1040065332 8:43140387-43140409 CGGCGGTGACGGCAGCGGAGGGG + Intergenic
1041271416 8:56113067-56113089 CCTCGAAGACGGCAGCGGAGAGG + Exonic
1043464083 8:80487386-80487408 CCTGGGCGACGGCAGCGGGGCGG + Exonic
1057232856 9:93335381-93335403 CAACGACGAGGGCAGCGGAGGGG - Exonic
1057252656 9:93516240-93516262 CAACGACGAGGGCAGCGGAGGGG + Exonic
1203773920 EBV:62465-62487 CATCGAAGAGGGCAGCGGGGAGG - Intergenic
1185682895 X:1903081-1903103 CCGCAAAGTCGGCAGCAGAGTGG + Intergenic
1195274461 X:103267792-103267814 CCTGGAAGAGTGCAGCGGAGAGG - Intergenic